"
Team:KULeuven/Primers
From 2009.igem.org
(Difference between revisions)
| Line 11: | Line 11: | ||
! class='top' | Comments | ! class='top' | Comments | ||
|- | |- | ||
| - | |2171||BLR promoter fw||CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC||46||52.4||it has a catcat and prefix (not in Tm included) | + | |2171||BLR promoter large fw||CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC||46||52.4||it has a catcat and prefix (not in Tm included) |
| + | |- | ||
| + | |2172||BLR promoter large rv||CTG CAG CGG CCG CTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included) | ||
|- | |- | ||
| - | | | + | |2260||BLR promoter exact fw||CAT CAT GAA TTC GCG GCC GCT TCT AGA GAT TGC AAA AAA TTA ATT TAT CAT TCT G||55||52.4||it has a catcat and prefix (not in Tm included) |
| + | |- | ||
| + | |2261||BLR promoter exact rv||CTG CAG CGG CCG CTA CTA GTA AAA AAT GTT AAT CAA TGT TAA GTG AAG||48||52.1||it has a suffix (not in Tm included) | ||
|} | |} | ||
Revision as of 09:32, 11 August 2009
| Number | Name | Sequence | Length | Tm (°C) | Comments |
|---|---|---|---|---|---|
| 2171 | BLR promoter large fw | CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC | 46 | 52.4 | it has a catcat and prefix (not in Tm included) |
| 2172 | BLR promoter large rv | CTG CAG CGG CCG CTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG | 51 | 52.1 | it has a suffix (not in Tm included) |
| 2260 | BLR promoter exact fw | CAT CAT GAA TTC GCG GCC GCT TCT AGA GAT TGC AAA AAA TTA ATT TAT CAT TCT G | 55 | 52.4 | it has a catcat and prefix (not in Tm included) |
| 2261 | BLR promoter exact rv | CTG CAG CGG CCG CTA CTA GTA AAA AAT GTT AAT CAA TGT TAA GTG AAG | 48 | 52.1 | it has a suffix (not in Tm included) |
