"
Team:KULeuven/Primers
From 2009.igem.org
(Difference between revisions)
| Line 15: | Line 15: | ||
|2172||BLR promoter large rv||CTG CAG CGG CCG CTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included) | |2172||BLR promoter large rv||CTG CAG CGG CCG CTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG||51||52.1||it has a suffix (not in Tm included) | ||
|- | |- | ||
| - | |2260||BLR promoter exact fw||CAT CAT GAA TTC GCG GCC GCT TCT AGA GAT TGC AAA AAA TTA ATT TAT CAT TCT G||55|| | + | |2260||BLR promoter exact fw||CAT CAT GAA TTC GCG GCC GCT TCT AGA GAT TGC AAA AAA TTA ATT TAT CAT TCT G||55||48.6||it has a catcat and prefix (not in Tm included) |
|- | |- | ||
| - | |2261||BLR promoter exact rv||CTG CAG CGG CCG CTA CTA GTA AAA AAT GTT AAT CAA TGT TAA GTG AAG||48|| | + | |2261||BLR promoter exact rv||CTG CAG CGG CCG CTA CTA GTA AAA AAT GTT AAT CAA TGT TAA GTG AAG||48||49.6||it has a suffix (not in Tm included) |
|} | |} | ||
Revision as of 15:20, 11 August 2009
| Number | Name | Sequence | Length | Tm (°C) | Comments |
|---|---|---|---|---|---|
| 2171 | BLR promoter large fw | CATCAT GAATTCGCGGCCGCTTCTAGAG TTT GAC AGG TTC GTC GTC | 46 | 52.4 | it has a catcat and prefix (not in Tm included) |
| 2172 | BLR promoter large rv | CTG CAG CGG CCG CTACTAGTA CCT CTG TTA AAA ATG TTA ATC AAT GTT AAG | 51 | 52.1 | it has a suffix (not in Tm included) |
| 2260 | BLR promoter exact fw | CAT CAT GAA TTC GCG GCC GCT TCT AGA GAT TGC AAA AAA TTA ATT TAT CAT TCT G | 55 | 48.6 | it has a catcat and prefix (not in Tm included) |
| 2261 | BLR promoter exact rv | CTG CAG CGG CCG CTA CTA GTA AAA AAT GTT AAT CAA TGT TAA GTG AAG | 48 | 49.6 | it has a suffix (not in Tm included) |
