Team:NTU-Singapore/Project/Prototype/Image

From 2009.igem.org

(Difference between revisions)

Revision as of 20:30, 20 October 2009

Welcome to the project page!

Navigation

Why Atherosclerosis? System Specifications Research proposal Prototype Design Sensing Device « Degradation Device « Imaging Device « Parts References

Imaging Device

Abstract

As part of the imaging capability we want for our system, we have eschewed traditional reporter proteins like GFP or YFP and have identified a novel reporter protein, infrared fluorescent protein (IFP). A recent work by Xiaokun et. al. (Tsien Lab, UCSD) has shown successful mammalian expression of infrared fluorescent protein engineered from a bacterial phytochrome. Xiaokun et. al. have also expressed the infrared fluorescent protein in E. coli strain TOP10.

IFP is preferred for our system over other FPs such as GFP or YFP because it has a unique excitation and emission maxima of 684 and 708 nm respectively. The excitation and emission maxima for other fluorescent proteins have not exceeded 598 and 655 nm respectively. The wavelength range of IFP fits so well with the wavelength range of typical in vivo optical imaging in deep tissues of animals i.e. between 650 and 900 nm for excitation and emission maxima respectively. This is because this range of wavelength minimizes the absorbance by haemoglobin, water and lipids, as well as light-scattering.

Therefore, IFP is particularly suitable for our ideal system as we desire to locate the atherosclerotic plaque site without invasive procedures.

Background

Mechanism

Infrared fluorescent protein is a monomeric protein engineered from a bacterial phytochrome of the species Deinococcus radiodurans.

This bacteriophytochrome incorporates biliverdin IXα (BV) as the chromophore. Biliverdin IXα is in fact a natural product of heme catabolism by the enzyme heme oxygenase-1 (HO-1). BV is essential because in a mouse experiment conducted by Xiaokun et. al., BV has been shown to increase the infrared fluorescence to a maximal fivefold 1 hour after BV injection in the mouse with exogenously added BV.

In a phone call made to Dr. Xiaokun Shu, we have also been told that BV helps to stabilize the infrared fluorescent protein. Hence, it is essential that we incorporate HO-1 into our system to generate biliverdin IXα.

Sequence

Using NCBI’s reference sequence NC_000913.2, the 186 bp NorR-NorVW intergenic region sequence is obtained using E.coli (strain: K-12; sub-strain: MG1655) as the search organism. The sequence is found in genome position 2830311 – 2830496. The NorR-NorVW intergenic sequence is as follows (5’ - 3’):

TCTTTGCCTCACTGTCAATTTGACTATAGATATTGTCATATCGACCATTTGATTGATAGTCATTTTGACT
ACTCATTAATGGGCATAATTTTATTTATAGAGTAAAAACAATCAGATAAAAAACTGGCACGCAATCTGCA
ATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC

The highlighted sequence is the sigma-54 promoter. The reason why we had included the entire intergenic region as our pNO promoter sequence is that there are 3 enhancer binding sites upstream of the sigma-54 promoter. These enhancer binding sites allow the transcription factor, NorR to bind to the DNA, thus leading to a localized increase in NorR concentration.

As such, the increase in localized NorR concentration facilitates the NorR to make contact with the sigma 54 – RNA polymerase.

Construct Design

In our system, Plaque Out!, we wish to regulate the production of TetR protein with respect to the concentration of NO.

The TetR protein would in turn regulate the production of Cholesterol esterase (CHE), Haem Oxyenase (HO-1), and Infra-red protein (IFP). Thus, our NO sensing construct is as follows:

Characteristic Equations

Ligand binding :

Using Hill equation to express the fraction of NO-bound NorR, we assume independent and non-cooperative binding of NO (i.e. Hill coefficient is taken to be 1).

Thus, fraction of NO-bound NorR is described as follows:

$NTUnorrfrac.png$

Since the dissociation constant Kd1 can be illustrated as:

Fraction of NO-bound NorR can be expressed as a function of available NO concentration, [NO]free

Transcription of TetR

Deterministic first order differential equation (ODE) is used to depict the NO-regulated transcription of TetR.

Where Vmax is max transcription rate & Dm is the degradation rate of mRNA.

Translation of TetR

Deterministic first order ODE is used again to represent the translation of TetR protein.

Where Ktl is the translation rate of mRNA & Dp is the degradation rate of TetR protein.

Modelling & Simulation

We make the following assumptions:

Biological systems of transcription and translation are assumed to be linear and time-invariant
Concentration of the transcription factor, NorR in E.coli is assumed to be in excess and constant. Hence, [NorR] is not taken into account in our model
There is no time lag for NO diffusion from ext. environment into the cell
Constant Degradation rates for mRNA as well as protein

Instead of modelling with TetR, we are using GFP as our output. This is part of our effort in trying to predict the wetlab characterization of pNO.

The following is our Sensing device represented as a Simulink system. Please click on it for a larger view.

Device Construction

Device Characterization

Literature / References

Please proceed here to view our full list of references.

TOP || iGEM '09

NTU@iGEMcc 2009. Some rights reserved.

@@ Line 51: / Line 51: @@
 == Abstract ==
-Nitric-oxide (NO) sensing promoter (pNO) is a sigma-54 promoter that is regulated by transcription factor NorR, a member of the prokaryotic EBP (enhancer binding protein) family.
+As part of the imaging capability we want for our system, we have eschewed traditional reporter proteins like GFP or YFP and have identified a novel reporter protein, infrared fluorescent protein (IFP). A recent work by Xiaokun et. al. (Tsien Lab, UCSD) has shown successful mammalian expression of infrared fluorescent protein engineered from a bacterial phytochrome. Xiaokun et. al. have also expressed the infrared fluorescent protein in E. coli strain TOP10.
-NorR is a NO responsive transcription factor which is activated by interaction with NO. Upon activation, NorR will convert the inactive promoter bound sigma-54 RNA polymerase complex to a transcriptionally competent complex in pNO to promote the downstream transcription of the gene.
-Thus, expression of the gene downstream of pNO can be regulated by input of NO.
+IFP is preferred for our system over other FPs such as GFP or YFP because it has a unique excitation and emission maxima of 684 and 708 nm respectively. The excitation and emission maxima for other fluorescent proteins have not exceeded 598 and 655 nm respectively.  The wavelength range of IFP fits so well with the wavelength range of typical ''in vivo'' optical imaging in deep tissues of animals i.e. between 650 and 900 nm for excitation and emission maxima respectively. This is because this range of wavelength minimizes the absorbance by haemoglobin, water and lipids, as well as light-scattering.
+Therefore, IFP is particularly suitable for our ideal system as we desire to locate the atherosclerotic plaque site without invasive procedures.
-In our project to tackle atherosclerosis, we seek to locate the presence of the plaque via the detection of NO concentration in the blood vessels. It has been shown that the cholesterol-induced atherosclerosis would usually impair the NO synthesizing ability of the vascular endothelial cells, and thereby leads to a decrease of NO concentration in the plaque region.
-By equipping our host cells (preferably T-helper cells; however in our experiment, we have used E.coli) with pNO, our system Plaque Out! will sense the decrease in NO concentration in the plaque region.
-This will trigger an inverter module to:
-# secrete cholesterol esterase (CHE) to digest the plaque
-# produce infra-red signals to highlight the plaque’s location and
-# release NO to dilate the vessel after digestion of plaque.
-'''Hence, pNO would serve as the main switch for our system Plaque Out!.'''
@@ Line 76: / Line 62: @@
 == Background ==
-Based on the above described function, we have decided to include the entire NorR-NorV/W intergenic region (in E.coli genome) as our pNO promoter sequence. NorV/W genes encode for flavorubredoxin and an associated flavoprotein which would reduce NO to nitrous oxide.
-[[Image:NTUnorr.png|center]]
-These NorR and NorVW genes can be found in most proteobacteria, especially E.coli. And they are part of an important mechanism that allows bacteria to survive in anaerobic conditions as well as during nitrosative stress. In these cases, NorR protein serves as a NO-responsive transcriptional activator that regulates expression of the norVW genes.
+=== Mechanism ===
+Infrared fluorescent protein is a monomeric protein engineered from a bacterial phytochrome of the species ''Deinococcus radiodurans''.
-=== Mechanism ===
+This bacteriophytochrome incorporates biliverdin IXα (BV) as the chromophore. Biliverdin IXα is in fact a natural product of heme catabolism by the enzyme heme oxygenase-1 (HO-1). BV is essential because in a mouse experiment conducted by Xiaokun et. al., BV has been shown to increase the infrared fluorescence to a maximal fivefold 1 hour after BV injection in the mouse with exogenously added BV.
-In the absence of NO, the N-terminal domain of transcription factor NorR typically represses the ATPase activity of NorR.
-It is only when NO binds to the ferrous iron center of NorR, it would stimulate ATP hydrolysis by NorR.  The ATPase activity of NorR is boosted by binding of NorR to the three enhancer binding sites located upstream in the pNO.
-The energy released by ATP hydrolysis enables NorR to activate pNO bound sigma-54 RNA polymerase complex (or RNA polymerase holoenzyme), thus initiating the transcription process.
+In a phone call made to Dr. Xiaokun Shu, we have also been told that BV helps to stabilize the infrared fluorescent protein. Hence, it is essential that we incorporate HO-1 into our system to generate biliverdin IXα.