Team:Kyoto/CiC/Modelling
From 2009.igem.org
- Home
- Cells in Cells
- Modelling
Experiment
Construction HIV-TAT::(LALAAAA)3 expressing vector
†RBS+HIV-TAT+HIStag+(LALAAAA)3 was made by elongation of primer dimer. (Forward primer;
cggaattcgcggccgcttctagagaaagaggagaaatactagATGTATGGACGTAAAAAACGTCGTGGACGTCGTCGTGGCGGCGGTCATCATCATCATCACCATGGCGG Reverse primer;
ctgcagcggccgctactagtaTTACGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGGGCCAGCGCGGCCGCCGCCAGGGCCAGGCCACCGCCATGGTGATGATGATG)
Signal for TIM23 complex::GFP expressing vector
†RBS+Signal for TIM23 complex::GFP+terminator was made by two-stage PCR.
First-stage PCR Forward primer;
TTTAAACCGGCGACCCGTACCCTGTGCTCTTCTCGTTATCTGCTGcgtaaaggagaagaacttttcactggagttg
Reverse primer;
agtgagctgataccgctcgc
Second-stage PCR Forward primer;
cggaattcgcggccgcttctagagaaagaggagaaatactagATGCTGAGCCTGCGTCAGTCTATTCGTTTTTTTAAACCGGCGACCCGTAC
Reverse primer;
agtgagctgataccgctcgc
Making proteoliposome by RTS
1. Remove the solvent of 50mM DOPC (Di-oleyl phosphatidylcholine, resolute in chloroform: methanol=2:1) 100μl in Ar.
2. Desiccate the DOPC in vacuum
3. Add 50mM HEPES-KOH 100μl
4. Adjust liposome size by mini-extruder of 200nm pore size filter
5. Making proteoloposome by RTS
6. Ultracentrifuge RTS product in 5, 10, 15, 20, 25% sucrose HEPES-KOH solution.
Observation
Subgoal A
In the experiment on subgoal A, we are aimed to confirm that the liposome with HIV-TAT can intrude mammalian cells.We will mix pSB1A2-T7 promoter- HIV-TAT::(LALAAAA)3-ter and liposome with fluorochrome and translated by RTS. When HIV-TAT::(LALAAAA)3 is translated, it sticks the lipid bilayer. As a result, the liposome which has HIV-TAT on their surface is completed. Adding it to HeLa cells. Later, we will observe the fluorescence of liposome in HeLa cells.
Subgoal B
In the experiment on subgoal B, we are aimed to confirm that the recombinant of TIM23 complex can work as a protein translocater for its signal peptide. First, we confirm that the protein with the signal peptide for yeast can be taken in yeast’s mitochondria. Second, we make proteoliposome which has the recombinant of yeast TIM23 complex and mix it in Signal for TIM23 complex::GFP which is translated by RTS. Then we will observe the localization of EGFP fluorescence.
"




