Team:Newcastle/Promoter Library


Promoter Library

Please click on the following links to learn more about the promoter library sub-project:


In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.

Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.

Novelty in this sub-project

The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.


Template used to create the promoter sequences:


Team Newcastle iGEM Promoter Library1.png

Team Newcastle iGEM Promoter Library2.png

  • BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
  • UpSpacer - attta - consensus sigA 5 bases 5'
  • -35 - TTGACA
  • PromSpacer - length 17 - consensus ttttatttaaattatga
  • -10 - TATAAT
  • DownSpacer (from ackA)- ggaaaag
  • BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag


We designed three degenerate sequences to create a library of promoters which we hope will have different strengths.

Variant 1

In this variant we only modified the -35 and -10 consensus sequences.

BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix

Team Newcastle iGEM Promoter Library3.png

Team Newcastle iGEM Promoter Library4.png

Variant 2

In the second variant we modified the promoter sequence between the -35 and -10 regions.

BBPrefix...UpSpacer...-35... 18Nā€™s...-10...DownSpacer..BBSuffix

Team Newcastle iGEM Promoter Library5.png

Team Newcastle iGEM Promoter Library7.png

Variant 3

In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region.


Team Newcastle iGEM Promoter Library6.png

Lab Work Strategies

  • Synthesis other strand using polymerase and a primer

Team Newcastle iGEM Promoter Library8.png

  • Cut promoter fragments using EcoR1 and Pst1
  • Cut pSB1AT3 vector using EcoR1 and Pst1
  • Ligate the insert and the plasmid backbone, and transform E. coli DH5alpha
  • Subclone into Bacillus integration vector with gfp and insert at amyE


The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised.
This is all of the lab work in which the Promoter Library team attempted to construct the promoter library - click on the dates to read that day's lab entry:

Summary of Lab Sessions for Promoter Library
26th August 2009 Digested 15ul of pGFP-rrnB plasmid with NheI and EcoRI
27th August 2009 Attempted to remove the pGFP-rrnB backbone fragment (digested yesterday) from agarose gel - yesterday's digests didn't work properly so second attempt made. Nonetheless, backbone fragment excised from gel and cleaned up
28th August 2009 Ran 10ul of pGFP-rrnB treated with EcoRI and 10ul of pGFP-rrnB + NheI on some agarose gel for analysis. Additionally, 5ul of the 8Kb pGFP-rrnB digest fragment was ran on gel.
1st September 2009 Attempted to amplify the three sets of sigA promoter using PCR
2nd September 2009 Carried out two DNA gel electrophoresis attempts in analysing the 3 variant sets of sigA promoters - both gel photographs show negative results
3rd September 2009 Cleaned up the PCR products for another run of DNA gel electrophoresis tomorrow.
4th September 2009 C0, V1, V2 and V3 PCR products analysis



Social Net

  • Newcastle iGEM Twitter
  • Newcastle on Facebook
  • Newcastle Youtube Channel