Team:TUDelft/Conjugation Procedure
From 2009.igem.org
(→Experimental Procedures) |
|||
(13 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
+ | {{Template:TUDelftiGEM2009_menu_M1_conj}} | ||
+ | ='''Experimental Procedures'''= | ||
+ | |||
+ | This page contains the step-by-step plan followed by the conjugation team and each steps current status. | ||
+ | |||
+ | =='''Section 1: Helper Plasmid'''== | ||
+ | |||
+ | ===Section 1: The Plan=== | ||
- | |||
- | |||
Part 1A: | Part 1A: | ||
- | *Acquire R751 | + | * Acquire R751 plasmid [https://2009.igem.org/Team:TUDelft/31_July_2009#Calin <font color=limegreen>✔</font>] |
- | + | * Confirm wild R751 conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>✔</font>]] | |
- | *Characterize conjugation efficiency | + | * Characterize conjugation efficiency [[Team:TUDelft/Conjugation_Results | <font color=limegreen>✔</font>]] |
- | Part 1B: | + | |
- | * | + | |
- | * | + | Part 1B: oriTR knockout |
- | *Verify that conjugation stopped | + | * Design and order primers needed for λ-red knockout [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>✔</font>] |
- | * | + | * Acquire knockout plasmids [https://2009.igem.org/Team:TUDelft/10_August_2009#Calin <font color=limegreen>✔</font>] |
- | * | + | * Knockout oriTR <font color=blue><b>**In Progress**</b></font> |
+ | * Verify that conjugation stopped <font color=blue><b>**In Progress**</b></font> | ||
+ | * Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper | ||
+ | * Send R751 ΔoriTR plasmid to registry | ||
+ | |||
+ | |||
Part 1C: trbK knockout | Part 1C: trbK knockout | ||
- | *Knockout | + | * Knockout trbK <font color=blue><b>**In Progress**</b></font> |
- | * | + | * Verify that conjugation takes place among R751 ΔtrbK cells |
- | *Verify that conjugation takes place among | + | * Characterize conjugation efficiency |
- | *Characterize conjugation efficiency | + | * Send R751 ΔoriT + ΔtrbK plasmid to registry |
- | * | + | |
+ | |||
Part 1D: trbC knockout | Part 1D: trbC knockout | ||
- | *Knockout | + | * Knockout trbC |
- | + | * Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1 | |
- | *Verify that no conjugation takes place in presence of | + | * Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry |
- | * | + | |
- | + | ||
+ | ===Knockouts=== | ||
+ | |||
+ | The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2): | ||
+ | |||
+ | trbK_KO_FWD (70 bp) | ||
+ | |||
+ | CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font> | ||
+ | |||
+ | trbK_KO_REV (70 bp) | ||
+ | |||
+ | GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACC<font color=red>ATGGGAATTAGCCATGGTCC</font> | ||
+ | |||
+ | oriTR_KO_FWD (70 bp) | ||
+ | |||
+ | TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font> | ||
+ | |||
+ | oriTR_KO_REV (70 bp) | ||
+ | |||
+ | TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCG<font color=red>ATGGGAATTAGCCATGGTCC</font> | ||
+ | |||
+ | The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region): | ||
+ | |||
+ | trbK_KO_FWD (20 bp) | ||
+ | |||
+ | <font color=blue>CACAACTGCG</font>CCAGGGCAGC | ||
+ | |||
+ | trbK_KO_REV (20 bp) | ||
+ | |||
+ | <font color=blue>CAGACGAACA</font>GCGGCAGGGC | ||
+ | |||
+ | oriTR_KO_FWD (20 bp) | ||
+ | |||
+ | <font color=blue>CTGGCCCACG</font>TCGCGCAGAT | ||
+ | |||
+ | oriTR_KO_REV (20 bp) | ||
+ | |||
+ | <font color=blue>TTGTGGCGGG</font>TTTCGCTATA | ||
+ | |||
+ | Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See [[Team:TUDelft/Conjugation_Results | Results]] page for more info. | ||
+ | |||
+ | =='''Section 2: Message Plasmid'''== | ||
Part 2A: BioBrick Assembly | Part 2A: BioBrick Assembly | ||
- | *Order DNA synthesis for [http://partsregistry.org/wiki/index.php?title=Part: | + | * Order DNA synthesis for |
- | *Amplify BioBricks needed [http://partsregistry.org/ | + | ** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>✔</font>] |
- | *Assemble: | + | ** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC) |
- | + | * Verify that trbK expression blocks conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>✔</font>]] | |
- | + | * Place trbK on standard backbone [https://2009.igem.org/Team:TUDelft/11_August_2009#Calin <font color=limegreen>✔</font>], sequence [https://static.igem.org/mediawiki/2009/9/9e/V92371145_E_VF_QS.txt <font color=limegreen>✔</font>], and send to registry <font color=limegreen>✔</font> | |
- | *Assemble | + | * Amplify and Transform BioBricks needed |
- | + | ** [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) <font color=limegreen>✔</font> | |
+ | ** [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR) <font color=limegreen>✔</font> | ||
+ | ** [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS) <font color=limegreen>✔</font> | ||
+ | ** [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) <font color=limegreen>✔</font> | ||
+ | * Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] <font color=limegreen>✔</font> | ||
+ | * Verify Conjugation Testing Plasmid 1 works. [[Team:TUDelft/Conjugation_Results | <font color=limegreen>✔</font>]] | ||
+ | * Sequence Conjugation Testing Plasmid 1. <font color=blue><b>**In Progress**</b></font> | ||
+ | * Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] <font color=limegreen>✔</font> | ||
+ | * Verify Conjugation Testing Plasmid 2 works. <font color=blue><b>**In Progress**</b></font> | ||
+ | * Sequence Conjugation Testing Plasmid 2. <font color=blue><b>**In Progress**</b></font> | ||
+ | |||
Part 2B: Full Communication testing | Part 2B: Full Communication testing | ||
- | *Electroporate | + | * Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid) |
- | + | * Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues. | |
- | + | * If signal propagation observed, do victory dance. | |
- | *Add | + | |
- | *If signal propagation observed, do victory dance. | + | |
'''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page''' | '''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page''' | ||
+ | |||
+ | On to the [[Team:TUDelft/Conjugation_Results | Experimental Results >>>]] | ||
+ | |||
+ | {{Template:TUDelftiGEM2009_end}} |
Latest revision as of 22:43, 19 October 2009
Experimental Procedures
This page contains the step-by-step plan followed by the conjugation team and each steps current status.
Section 1: Helper Plasmid
Section 1: The Plan
Part 1A:
Part 1B: oriTR knockout
- Design and order primers needed for λ-red knockout ✔
- Acquire knockout plasmids ✔
- Knockout oriTR **In Progress**
- Verify that conjugation stopped **In Progress**
- Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper
- Send R751 ΔoriTR plasmid to registry
Part 1C: trbK knockout
- Knockout trbK **In Progress**
- Verify that conjugation takes place among R751 ΔtrbK cells
- Characterize conjugation efficiency
- Send R751 ΔoriT + ΔtrbK plasmid to registry
Part 1D: trbC knockout
- Knockout trbC
- Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
- Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry
Knockouts
The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):
trbK_KO_FWD (70 bp)
CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTCGTGTAGGCTGGAGCTGCTTC
trbK_KO_REV (70 bp)
GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACCATGGGAATTAGCCATGGTCC
oriTR_KO_FWD (70 bp)
TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTCGTGTAGGCTGGAGCTGCTTC
oriTR_KO_REV (70 bp)
TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCGATGGGAATTAGCCATGGTCC
The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):
trbK_KO_FWD (20 bp)
CACAACTGCGCCAGGGCAGC
trbK_KO_REV (20 bp)
CAGACGAACAGCGGCAGGGC
oriTR_KO_FWD (20 bp)
CTGGCCCACGTCGCGCAGAT
oriTR_KO_REV (20 bp)
TTGTGGCGGGTTTCGCTATA
Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See Results page for more info.
Section 2: Message Plasmid
Part 2A: BioBrick Assembly
- Order DNA synthesis for
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) ✔
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
- Verify that trbK expression blocks conjugation ✔
- Place trbK on standard backbone ✔, sequence ✔, and send to registry ✔
- Amplify and Transform BioBricks needed
- [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) ✔
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR) ✔
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS) ✔
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) ✔
- Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] ✔
- Verify Conjugation Testing Plasmid 1 works. ✔
- Sequence Conjugation Testing Plasmid 1. **In Progress**
- Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] ✔
- Verify Conjugation Testing Plasmid 2 works. **In Progress**
- Sequence Conjugation Testing Plasmid 2. **In Progress**
Part 2B: Full Communication testing
- Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
- Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
- If signal propagation observed, do victory dance.
For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the cloning strategy page
On to the Experimental Results >>>