EPF-Lausanne/6 July 2009

From 2009.igem.org

(Difference between revisions)
Line 13: Line 13:
<br>-CBP is a small peptide with which we could purify LOVTAP protein
<br>-CBP is a small peptide with which we could purify LOVTAP protein
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
 +
==Cloning Strategy==
==Cloning Strategy==
Line 28: Line 29:
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
 +
==People in the lab==
==People in the lab==

Revision as of 15:41, 27 July 2009

Contents

Wet Lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid


Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified


Cloning Strategy

Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg

2.RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag

3.CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag

4.LOVTAP:

gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac

One reverse primer were designed:

gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc

The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1


People in the lab

Tu, Heidi, Rafael, Basile, Nath