EPF-Lausanne/6 July 2009
From 2009.igem.org
(→People in the lab) |
(→People in the lab) |
||
(8 intermediate revisions not shown) | |||
Line 2: | Line 2: | ||
<div CLASS="epfltrick">__TOC__ | <div CLASS="epfltrick">__TOC__ | ||
</div><div CLASS="epfl09"> | </div><div CLASS="epfl09"> | ||
+ | |||
+ | <html> | ||
+ | <body> | ||
+ | <form action="input_button.htm"> | ||
+ | <p align="right"> | ||
+ | <input type="button" name="lien" value="7 July 2009" | ||
+ | onClick="self.location.href='https://2009.igem.org/EPF-Lausanne/7_July_2009'"> | ||
+ | </p> | ||
+ | </form> | ||
+ | </body> | ||
+ | </html> | ||
<html><center> | <html><center> | ||
Line 43: | Line 54: | ||
:Tu, Heidi, Rafael, Basile, Nath | :Tu, Heidi, Rafael, Basile, Nath | ||
- | |||
- | <html><center><a href="https://2009.igem.org/EPF-Lausanne/7_July_2009"><img src="https://static.igem.org/mediawiki/2009/5/5e/Fleche_droite.png"></a></center></html> | + | |
+ | <html><center><a href="https://2009.igem.org/EPF-Lausanne/7_July_2009"><img src="https://static.igem.org/mediawiki/2009/thumb/5/5e/Fleche_droite.png/70px-Fleche_droite.png"></a></center></html> | ||
Latest revision as of 09:12, 28 July 2009
Wet Lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
Cloning Strategy
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
People in the lab
- Tu, Heidi, Rafael, Basile, Nath