Team:TUDelft/Conjugation Procedure

From 2009.igem.org

(Difference between revisions)
(→Experimental Procedures)
 
(13 intermediate revisions not shown)
Line 1: Line 1:
 +
{{Template:TUDelftiGEM2009_menu_M1_conj}}
 +
='''Experimental Procedures'''=
 +
 +
This page contains the step-by-step plan followed by the conjugation team and each steps current status.
 +
 +
=='''Section 1: Helper Plasmid'''==
 +
 +
===Section 1: The Plan===
-
==Experimental Procedures==
 
-
'''Section 1: Helper Plasmid'''<br>
 
Part 1A:
Part 1A:
-
*Acquire R751 and/or RP4 plasmid
+
* Acquire R751 plasmid [https://2009.igem.org/Team:TUDelft/31_July_2009#Calin <font color=limegreen>&#10004;</font>]
-
*Electoporate plasmid into cells and confirm conjugation. See [http://openwetware.org/wiki/Conjugation conjugation protocol]  
+
* Confirm wild R751 conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
-
*Characterize conjugation efficiency
+
* Characterize conjugation efficiency [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
-
Part 1B: oriT knockout
+
 
-
*Knockout oriT using either [http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/IGEM:Peking/2007/Count:Knockout knockout protocol used by Peking '07] or [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]
+
 
-
*Electroporate into cells
+
Part 1B: oriTR knockout
-
*Verify that conjugation stopped
+
* Design and order primers needed for &lambda;-red knockout [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>&#10004;</font>]
-
*Electroporate PlasmidG as well and characterize conjugation efficiency
+
* Acquire knockout plasmids [https://2009.igem.org/Team:TUDelft/10_August_2009#Calin <font color=limegreen>&#10004;</font>]
-
*If works send R751 oriT knockout plasmid to registry
+
* Knockout oriTR <font color=blue><b>**In Progress**</b></font>
 +
* Verify that conjugation stopped <font color=blue><b>**In Progress**</b></font>
 +
* Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 &Delta;oriTR as helper
 +
* Send R751 &Delta;oriTR plasmid to registry
 +
 
 +
 
Part 1C: trbK knockout
Part 1C: trbK knockout
-
*Knockout oriT + trbK
+
* Knockout trbK <font color=blue><b>**In Progress**</b></font>
-
*Electroporate into cells
+
* Verify that conjugation takes place among R751 &Delta;trbK cells
-
*Verify that conjugation takes place among R+ cells using PlasmidG (see below)
+
* Characterize conjugation efficiency
-
*Characterize conjugation efficiency
+
* Send R751 &Delta;oriT + &Delta;trbK plasmid to registry
-
*If works send R751 oriT + trbK knockout plasmid to registry
+
 
 +
 
Part 1D: trbC knockout
Part 1D: trbC knockout
-
*Knockout oriT + trbK + trbC
+
* Knockout trbC
-
*Electroporate into cells and create culture for communication (cultureCom)
+
* Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
-
*Verify that no conjugation takes place in presence of PlasmidG
+
* Send R751 &Delta;oriT + &Delta;trbK + &Delta;trbC plasmid to registry
-
*If works send R751 oriT + trbK + trbC knockout plasmid to registry
+
-
'''Section 2: Message Plasmid'''<br>
+
 +
===Knockouts===
 +
 +
The &lambda;-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):
 +
 +
trbK_KO_FWD (70 bp)
 +
 +
CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font>
 +
 +
trbK_KO_REV (70 bp)
 +
 +
GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACC<font color=red>ATGGGAATTAGCCATGGTCC</font>
 +
 +
oriTR_KO_FWD (70 bp)
 +
 +
TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font>
 +
 +
oriTR_KO_REV (70 bp)
 +
 +
TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCG<font color=red>ATGGGAATTAGCCATGGTCC</font>
 +
 +
The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):
 +
 +
trbK_KO_FWD (20 bp)
 +
 +
<font color=blue>CACAACTGCG</font>CCAGGGCAGC
 +
 +
trbK_KO_REV (20 bp)
 +
 +
<font color=blue>CAGACGAACA</font>GCGGCAGGGC
 +
 +
oriTR_KO_FWD (20 bp)
 +
 +
<font color=blue>CTGGCCCACG</font>TCGCGCAGAT
 +
 +
oriTR_KO_REV (20 bp)
 +
 +
<font color=blue>TTGTGGCGGG</font>TTTCGCTATA
 +
 +
Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See [[Team:TUDelft/Conjugation_Results | Results]] page for more info.
 +
 +
=='''Section 2: Message Plasmid'''==
Part 2A: BioBrick Assembly
Part 2A: BioBrick Assembly
-
*Order DNA synthesis for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC) and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK)
+
* Order DNA synthesis for  
-
*Amplify BioBricks needed [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (GFP generator), [http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034 BBa_B0034] (strong rbs), [http://partsregistry.org/wiki/index.php?title=Part:BBa_J23100 BBa_J23100] (constitutive promoter), [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriT-R).
+
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>&#10004;</font>]
-
*Assemble: [oriT][promoter] and keep this for later
+
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
-
*Assemble PlasmidG: [oriT][promoter][GFP generator] + plasmid backbone with different resistance than helper plasmid and low copy number.
+
* Verify that trbK expression blocks conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
-
*Assemble [oriT][promoter][rbs][trbC][rbs][trbK] and keep this intermediate assembly product for possible use in integration stage
+
* Place trbK on standard backbone [https://2009.igem.org/Team:TUDelft/11_August_2009#Calin <font color=limegreen>&#10004;</font>], sequence [https://static.igem.org/mediawiki/2009/9/9e/V92371145_E_VF_QS.txt <font color=limegreen>&#10004;</font>], and send to registry <font color=limegreen>&#10004;</font>
-
*Assemble [oriT][promoter][rbs][trbC][rbs][trbK][GFP generator] and keep this intermediate assembly product for possible use in integration stage
+
* Amplify and Transform BioBricks needed
-
*Assemble PlasmidCKG: [oriT][promoter][rbs][trbC][rbs][trbK][GFP generator] + plasmid backbone with different resistance than helper plasmid and low copy number.
+
** [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
 +
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR) <font color=limegreen>&#10004;</font>
 +
**  [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS) <font color=limegreen>&#10004;</font>
 +
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
 +
* Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] <font color=limegreen>&#10004;</font>
 +
* Verify Conjugation Testing Plasmid 1 works. [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
 +
* Sequence Conjugation Testing Plasmid 1. <font color=blue><b>**In Progress**</b></font>
 +
* Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] <font color=limegreen>&#10004;</font>
 +
* Verify Conjugation Testing Plasmid 2 works. <font color=blue><b>**In Progress**</b></font>
 +
* Sequence Conjugation Testing Plasmid 2. <font color=blue><b>**In Progress**</b></font>
 +
 
Part 2B: Full Communication testing
Part 2B: Full Communication testing
-
*Electroporate PlasmidCKG into some cells from cultureCom creating initiatorCells
+
* Electroporate Conjugation Testing Plasmid 2 into some R751 &Delta;oriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
-
*Select for presence of both message and helper plasmid
+
* Add InitiatorCells to a culture of R751 &Delta;oriT + &Delta;trbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
-
*Mix initiatorCells with cells not containing any plasmids and characterize conjugation efficiency
+
* If signal propagation observed, do victory dance.
-
*Add initiatorCells to cultureCom and observe signal propagation, characterize rate of signal propagation.
+
 
-
*If signal propagation observed, do victory dance.
+
'''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page'''
'''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page'''
 +
 +
On to the [[Team:TUDelft/Conjugation_Results | Experimental Results >>>]]
 +
 +
{{Template:TUDelftiGEM2009_end}}

Latest revision as of 22:43, 19 October 2009

Experimental Procedures

This page contains the step-by-step plan followed by the conjugation team and each steps current status.

Section 1: Helper Plasmid

Section 1: The Plan

Part 1A:

  • Acquire R751 plasmid ✔
  • Confirm wild R751 conjugation ✔
  • Characterize conjugation efficiency ✔


Part 1B: oriTR knockout

  • Design and order primers needed for λ-red knockout ✔
  • Acquire knockout plasmids ✔
  • Knockout oriTR **In Progress**
  • Verify that conjugation stopped **In Progress**
  • Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper
  • Send R751 ΔoriTR plasmid to registry


Part 1C: trbK knockout

  • Knockout trbK **In Progress**
  • Verify that conjugation takes place among R751 ΔtrbK cells
  • Characterize conjugation efficiency
  • Send R751 ΔoriT + ΔtrbK plasmid to registry


Part 1D: trbC knockout

  • Knockout trbC
  • Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
  • Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry

Knockouts

The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):

trbK_KO_FWD (70 bp)

CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTCGTGTAGGCTGGAGCTGCTTC

trbK_KO_REV (70 bp)

GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACCATGGGAATTAGCCATGGTCC

oriTR_KO_FWD (70 bp)

TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTCGTGTAGGCTGGAGCTGCTTC

oriTR_KO_REV (70 bp)

TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCGATGGGAATTAGCCATGGTCC

The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):

trbK_KO_FWD (20 bp)

CACAACTGCGCCAGGGCAGC

trbK_KO_REV (20 bp)

CAGACGAACAGCGGCAGGGC

oriTR_KO_FWD (20 bp)

CTGGCCCACGTCGCGCAGAT

oriTR_KO_REV (20 bp)

TTGTGGCGGGTTTCGCTATA

Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See Results page for more info.

Section 2: Message Plasmid

Part 2A: BioBrick Assembly

  • Order DNA synthesis for
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
  • Verify that trbK expression blocks conjugation ✔
  • Place trbK on standard backbone ✔, sequence ✔, and send to registry ✔
  • Amplify and Transform BioBricks needed
    • [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) ✔
  • Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] ✔
  • Verify Conjugation Testing Plasmid 1 works. ✔
  • Sequence Conjugation Testing Plasmid 1. **In Progress**
  • Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] ✔
  • Verify Conjugation Testing Plasmid 2 works. **In Progress**
  • Sequence Conjugation Testing Plasmid 2. **In Progress**


Part 2B: Full Communication testing

  • Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
  • Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
  • If signal propagation observed, do victory dance.


For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the cloning strategy page

On to the Experimental Results >>>

Retrieved from "http://2009.igem.org/Team:TUDelft/Conjugation_Procedure"