Team:TUDelft/Conjugation Procedure

From 2009.igem.org

Experimental Procedures

This page contains the step-by-step plan followed by the conjugation team and each steps current status.

Section 1: Helper Plasmid

Section 1: The Plan

Part 1A:

  • Acquire R751 plasmid ✔
  • Confirm wild R751 conjugation ✔
  • Characterize conjugation efficiency ✔


Part 1B: oriTR knockout

  • Design and order primers needed for λ-red knockout ✔
  • Acquire knockout plasmids ✔
  • Knockout oriTR **In Progress**
  • Verify that conjugation stopped **In Progress**
  • Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper
  • Send R751 ΔoriTR plasmid to registry


Part 1C: trbK knockout

  • Knockout trbK **In Progress**
  • Verify that conjugation takes place among R751 ΔtrbK cells
  • Characterize conjugation efficiency
  • Send R751 ΔoriT + ΔtrbK plasmid to registry


Part 1D: trbC knockout

  • Knockout trbC
  • Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
  • Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry

Knockouts

The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):

trbK_KO_FWD (70 bp)

CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTCGTGTAGGCTGGAGCTGCTTC

trbK_KO_REV (70 bp)

GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACCATGGGAATTAGCCATGGTCC

oriTR_KO_FWD (70 bp)

TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTCGTGTAGGCTGGAGCTGCTTC

oriTR_KO_REV (70 bp)

TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCGATGGGAATTAGCCATGGTCC

The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):

trbK_KO_FWD (20 bp)

CACAACTGCGCCAGGGCAGC

trbK_KO_REV (20 bp)

CAGACGAACAGCGGCAGGGC

oriTR_KO_FWD (20 bp)

CTGGCCCACGTCGCGCAGAT

oriTR_KO_REV (20 bp)

TTGTGGCGGGTTTCGCTATA

Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See Results page for more info.

Section 2: Message Plasmid

Part 2A: BioBrick Assembly

  • Order DNA synthesis for
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
  • Verify that trbK expression blocks conjugation ✔
  • Place trbK on standard backbone ✔, sequence ✔, and send to registry ✔
  • Amplify and Transform BioBricks needed
    • [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS) ✔
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) ✔
  • Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] ✔
  • Verify Conjugation Testing Plasmid 1 works. ✔
  • Sequence Conjugation Testing Plasmid 1. **In Progress**
  • Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] ✔
  • Verify Conjugation Testing Plasmid 2 works. **In Progress**
  • Sequence Conjugation Testing Plasmid 2. **In Progress**


Part 2B: Full Communication testing

  • Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
  • Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
  • If signal propagation observed, do victory dance.


For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the cloning strategy page

On to the Experimental Results >>>

Retrieved from "http://2009.igem.org/Team:TUDelft/Conjugation_Procedure"