Team:Valencia/Notebook/August

From 2009.igem.org

August 5th

Today we have prepared the Coelenterazine stock dissolution. First we "put" N2 gas through a Methanol dissolution in order to substitute the O2, an inhibitor for the coelenterazine. After 5 or 10 minutes we took 200 microL and added them to 50 microg of Coelenterazine.

Then we have distribute them in eppendorfs of 5 microL each and kept them in the fridge at -20º.

For other side, we doubt if our yeast in the YPD medium have grown or not... We think we should wait until tomorrow... T-T... Like Cristina says, our yeasts are like Peter Pan: they don't want to grow up...

August 6th

Yeast have grown. YEaaaaaaaaaaaaahhhh!!! We have spread them into the SD solid medium lacking Leu that we did yesterday, we will wait until tomorrow for the results. Also we have prepared new SD liquid medium lacking Leu and once prepared we will also spread our super-yeasts in it. Tomorrow we will start with the protocol (we hope).

August 7th

Yeast have grown in SD medium lacking Leu (bothsolid and liquid) so we have started the protocol. The OD was low (0'18) but we have prepared an 1'8 OD dissolution of the yeasts by centrifugation and dilution with SD medium lacking Leu.

Allright... well... we have mesured the "luminiscence" and we have seen nothing. We've made the experiment in an espectophotometer and in the electrophoresis gel photograph machine. Before the mesurements we checked the OD and it was 0'34 so very far from 1'8. Maybe that's the problem. We're not depressed anyway, on monday we will come back to demonstrate those yeasts what we can do. Valencia's iGEM way.

August 10th

Today, we've made a lot of things. Yeasts haven't grown after three days in SD lacking Leu liquid medium at 30º. We've found out that we were preparing the medium in the wrong way.

The right way is:

For 500ml:

- 2'5 g (NH4)2SO4

- 1 g Yeast Synthetic Drop-Out Medium Supplement Without Leucine

- 10 g Glucose

- 7'5 g Agar (only for the solid medium)

We have also found out that the minimal volume for the spectophotometer is 400 microL so we will double all the quantities of the protocol.

August 11th

We repeated the protocol and we mesured in the espectrophotometer but we saw nothing. We think it's too few sensitive and we're going to ask for a fluorimeter. We also did the experiment in GelDoc but, again, we saw nothing.

August 12th

New yeasts have arrived. We have also prepared a mechanism to mesure in the GelDoc at the same time we add the KOH with the door closed and no delay, but we haven't obtained a single flash recorded.

We have found an espectrofluormeter and we will start to use it tomorrow.

August 13th

We have mesured the new yeasts in the espectrofluorimeter, with no incident ray, but we have only recorded noise. Then we have realized that we've mesuring at 465 nm, the wave length of the normal coelenterazine, where the one that we are using emits more light, but it does it at 444nm.

Note: We have wake up really early, at 6 a.m. The sunrise in the Cavanilles is weirdly beautiful ^^

We also have recorded a freak advertisement about one of us inventions for the experimental procedure: the Pippete Enlarger (you can watch it in ....)

August 14th

Another sunrise surrounded by yeasts... We have repeated yesterday's experiment at the right wavelenght (444 nm) but we haven't obtain results.

August 17th

We have designed our primers to amplify aequorin gene, the only "physical" BioBrick we're going to do by now. We have also asked for it. Probably, them will arrive in that week.

Carles is in Banyuls (France) making a short course. Angeles and Cristina will entrust with lab work for 10 days.

August 18th

We have made a solution at 50% with our three yeasts strains and glicerol. Later, we have put them in the freezer.

August 19th

We have repeated the experiment again but this time we have changed coelenterazine concentration from 2 to 5 micromolar and the incubation has been longer (8 hours). No results.

New coelenterazine (native) has arrived.

August 20th

Native coelenterazine has been resuspended as the protocol says.

Our primers have arrived and tomorrow we begin with all BioBricks work.

August 21st

We have repited our initial protocol (coelenterazine at 2 micromolar, and incubation about 5,5 hours), but now with native coelenterazine. We have started the experiment at 5.30 a.m. because we needed everything ready at 12.00. Lab work is a really hard thing... ¬¬

If we don't obtain results with the fluorimetre, I commite suicide...

Well, we have prepared three samples:

1. One acording to the original protocol with KOH.

2. One with the CaCl2 1,33M (see our protocol).

3. And, in a desesperate way, we have added KOH and CaCl2 together as a kind of "mixtured-input" (30 microlitres of everyone) to a third sample.

We haven't seen nothing... I'm gonna commite suicide...

For the other side, we have started our BioBricks work. We have prepare a PCR to amplify aequorin gene. Our samples were DNA from our three yeast strains (WT, Cch1- and Mid1-). We obtein them boiling our strains for 5 minutes. After the typical 30 cycles, we have run an agarose 0,8% gel with the PCR products. We runned a Molecular Weight Marker in two little holes (GeneRuler DNA Ladder Mix #SM0333 ng/0,5micrograms %).

Aequorin sequence:

1 atgaccagcg accaatactc agtcaagctt acatcagact tcgacaaccc aagatggatt

61 ggacgacaca agcatatgtt caatttcctt gatgtcaacc acaatggaaa aatctctctt

121 gacgagatgg tctacaaggc atctgatatt gtcatcaata accttggagc aacacctgag

181 caagccaaac gacacaaaga tgctgtagga gccttcttcg gaggagctgg aatgaaatat

241 ggtgtggaaa ctgattggcc tgcatacatt gaaggatgga aaaaattggc tactgatgaa

301 ttggagaaat acgccaaaaa cgaaccaacg ctcatccgta tatggggtga tgctttgttt

361 gatatcgttg acaaagatca aaatggagct attacactgg atgaatggaa agcatacacc

421 aaagctgctg gtatcatcca atcatcagaa gattgcgagg aaacatccag agtgtgcgat

481 attgatgaaa gtggacaact cgatgttgat gagatgacaa gacaacattt aggattttgg

541 tacaccatgg atcctgcttg cgaaaagctc tacggtggag ctgtccccta a

Our oligos were:

Forward: 5'gaattcgcggccgcttctagatgaccagcg 3’

Reverse: 5’tactagtagcggccgctgcagttaggggac 3’

To increase our desesperate state, there were'nt any amplification. Only primer-primers/primer-dimers...

1, 2, 3 = wt (1 microlitre)

4, 5, 6 = Cch1 (1 microlitre)

7, 8, 9 = Mid1 (1 microlitre)

10, 11 = Negative Control

Nevertheless, our PCR conditions were:

Components:

- 38,5 microlitres of H2O

- 5 microlitres of Buffer 10X (it contains Mg2+)

- 1 microlitre of our forward primer

- 2 microlitres of dNTP's 5 mM

- 1 microlitre of our reverse primer

- 1,5 microlitres of Taq 10 mM

- 1 microlitre of our DNA

Programme:

After 3 minutes at 94 ºC as a previous step, every of our 30 cycles has these three steps:

- 50s at 94 ºC

- 1min at 62 ºC

- 1min and 40s at 72 ºC

August 24th

We have repited the same PCR, but we changed some points:

Programme:

After 3 minutes at 94 ºC as a previous step, every of our 35 cycles has these trhee steps:

- 50s at 94 ºC

- 1min at 52 ºC

- 1min and 40s at 72 ºC

We have added one possitive control, too.

There was no amplification, even not in the possitive control. We have only seen bands of primerprimers and primer-dimers.

1, 2, 3 = wt (1 microlitre)

4, 5, 6 = Cch1 (1 microlitre)

7, 8, 9 = Mid1 (1 microlitre)

10 = Possitive Control

11 = Negative Control

(We used the same MWM)

We suspect about the termocycler. Tomorrow we will change to another one.

August 25th

We have repited the same PCR in 2 termocyclers: our termocycler and another one, but we have also changed some points:

Programme

After 2 minutes at 94 ºC as a previous step, every of our 35 cycles has these trhee steps:

- 50s at 94 ºC

- 45s at 55 ºC

- 1min and 30s at 72 ºC

Our possitive control is different from yesterday:

- 2 microlitres of dNTP's 5 mM

- 2 microlitres of primer F 20 ųM

- 2 microlitres of primer R 20 ųM

- 5 microlitres of Taq buffer 10X

- 1,5 microlitres of Taq (1U/microlitre)

- 37,7 microlitres of H2O mQ

The possitive control has been aplified succesfully, but our aequorin genes have not. We can rule out the hypothesis of a wrong-termocycle

1 & 7 = wt (1 microlitre)

2 & 8 = wt (2 microlitres)

3 & 9 = Cch1 (1 microlitre)

4 & 10 = Mid1 (1 microlitre)

5 & 11 = Negative Control

6 & 12 = Possitive Control

(We used the same MWM)

We have also repited our protocol with native coelenterazine. After the incubation, we have tried to see something in a fluorescence microscopy. We haven't got any result.

However, we had lots of fun ^^

August 26th

We have repited the same PCR in our termocycler. The new conditions for today are:

Programme

After 2 minutes at 94 ºC as a previous step, every of our 30 cycles has these trhee steps:

- 50s at 94 ºC

- 1min at 40 ºC

- 1min and 30s at 72 ºC

The components of the 50 microllitres eppendorf were the same of the yesterday possitive control and the same of the yesterday DNA-to-amplify.

1 = wt (1 microlitre)

2 = wt (2 microlitres)

3 = Cch1 (1 microlitre)

4 = Mid1 (1 microlitre)

5 = Negative Control

6 = Possitive Control

(We used the same MWM)

We had no results, not even in the possitive control. Our annealing temperature was not aproppiate.