"
Team:EPF-Lausanne/Notebook/Cloning Strategy
From 2009.igem.org
(→08.07.09) |
(→08.07.09) |
||
| Line 29: | Line 29: | ||
Inducible LOVTAP biobrick strategy | Inducible LOVTAP biobrick strategy | ||
:*Problem to overcome: | :*Problem to overcome: | ||
| - | Pst sites in LOVTAP sequence. | + | :Pst sites in LOVTAP sequence. |
:*Our goal: | :*Our goal: | ||
| - | Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order). | + | :Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order). |
:*Material: | :*Material: | ||
| - | Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate). | + | :Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate). |
:*Strategy: | :*Strategy: | ||
| - | LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP). | + | :LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP). |
| - | LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously). | + | :LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously). |
| - | Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX. | + | :Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX. |
===09.07.09=== | ===09.07.09=== | ||
Revision as of 15:50, 14 July 2009
Contents |
Cloning strategy
July
06.07.09
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
07.07.09
To design plasmids : software Vector NTI
08.07.09
Inducible LOVTAP biobrick strategy
- Problem to overcome:
- Pst sites in LOVTAP sequence.
- Our goal:
- Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order).
- Material:
- Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate).
- Strategy:
- LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP).
- LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously).
- Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX.
09.07.09
Partial digestion strategy.
10.07.09
13.07.09
Restriction enzymes on [http://www.neb.com/nebecomm/products/category1.asp?#2 Biolabs website] and [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp clevage oligonucleotides]
TRP promoter biobrick strategy
14.07.09
Primers designed for LOVTAP read-out and RBphP project:
1.Forward primer Trp promoter:
- gtttcttc gaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgc
2.Reverse primer Trp promoter:
- ctagctagctaggtcgataccctttttacgtgaacttgcgtactagttaactagttcgatgattaattgtca
3.1st Forward primer Inverter TetR:
- aatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc
4.2nd Forward primer Inverter TetR:
- gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta
5.Reverse Primer Inverter TetR:
- ctagctagctag tttctcctctttctctagtagtgc
6.Forward primer ppsR1 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatgctggaggatatttgccctggtg
7.Reverse primer ppsR1 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtattactcatcggctccgtctccttc
8.Forward primer ppsR2 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatggcgtcaaagtccgttcatgcc
9.Reverse primer ppsR2 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtatcaatcctctgcgtcgtctgagg
10.Forward primer BrBphP Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgcccgttccgctgacgac
11.Reverse primer BrBphP Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtatcactcctcgctctgcgagc
12.Forward primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgagggcgttcagagctcc
13.Reverse primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactattccaactgactgtcttcttcgc
14.Forward primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatggccgagtttcacggtccac
15.Reverse primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactagctccccttttcggtttcctc
