Team:KULeuven/13 July 2009

From 2009.igem.org

(Difference between revisions)
(Remarks)
 
(11 intermediate revisions not shown)
Line 1: Line 1:
-
{{Team:KULeuven/Common/BeginHeader}}
+
{{Team:KULeuven/Common2/BeginHeader}}
-
{{Team:KULeuven/Common/SubMenu_Project}}
+
{{Team:KULeuven/Common/SubMenu_Notebook}}
-
{{Team:KULeuven/Common/EndHeader}}
+
{{Team:KULeuven/Common2/EndHeader}}
{{Team:KULeuven/Notebook/DayNavigator}}
{{Team:KULeuven/Notebook/DayNavigator}}
Line 11: Line 11:
==Odor synthesis/sensor==
==Odor synthesis/sensor==
* Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
* Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
-
**Combination of 5 genes; 3 ervan zijn beschikbaar
+
**Combination of 5 genes; 3 are available
-
***[http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthese stappen door Edinburgh igem 2007)
+
***[https://2007.igem.org/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthesis pathway by Edinburgh igem 2007)
** [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp
** [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp
==Light sensor==
==Light sensor==
-
*YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
+
*''YcgF'' Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of ''YcgF'' gene for expression
*Probable strain K12
*Probable strain K12
-
*Promotor voor YCGF gene:
+
* Primer of YcgF Promotor:
**AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGC'''ATG''' (bron: [www.ncbi.nlm.nih.gov])
**AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGC'''ATG''' (bron: [www.ncbi.nlm.nih.gov])
-
==Odorless strain of E.coli==
+
==Odourless strain of ''E.coli''==
-
* [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline defficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
+
* [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline deficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
* Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'
* Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'
=To do=
=To do=
* Blue light receptor
* Blue light receptor
-
** Decide on E.Coli strain
+
** Decide on ''E.Coli'' strain
-
***try with K12
+
***Try with K12
***Vector in neural scent (indole knockout)
***Vector in neural scent (indole knockout)
**Decide on primers (!Pre + suffix!)
**Decide on primers (!Pre + suffix!)
**PCR of promotor
**PCR of promotor
**Couple promotor to GFP --> Standard iGEM plasmid
**Couple promotor to GFP --> Standard iGEM plasmid
-
**test!
+
**Test!
**Obtain regulation site
**Obtain regulation site
*Vanillin synthesis
*Vanillin synthesis
Line 39: Line 39:
*Presentations
*Presentations
*Order receptor biobrick
*Order receptor biobrick
-
** <Partinfo>BBa_J58105</Partinfo>
+
** {{kulpart|BBa_J58105}}
-
** Trg - Env2 <Partinfo>BBa_J58104</Partinfo>
+
** Trg - Env2 {{kulpart|BBa_J58104}}
**PBP
**PBP
Line 48: Line 48:
== Wiki ==
== Wiki ==
-
* create [[Team:KULeuven/Ideas|Ideas]] page
+
* Create [[Team:KULeuven/Ideas|Ideas]] page
* Some idiot replaced the example logo [[:Image:Example_logo.png]] with his own logo, so all references to it were removed from our wiki
* Some idiot replaced the example logo [[:Image:Example_logo.png]] with his own logo, so all references to it were removed from our wiki
-
= Wetlab =
+
[[Category:Team:KULeuven/Notebook/Wiki]]
 +
[[Category:Team:KULeuven/Notebook/Links]]
-
<div class='experiment'>
 
-
== Experiment Name ==
 
-
=== Description ===
 
-
=== Elaboration ===
 
-
=== Results and conclusions ===
 
-
</div>
 
-
= Remarks =
+
<!-- Don't edit below this line -->
-
 
+
__NOEDITSECTION__
-
 
+
= Progress of parts =
-
[[Category:Team:KULeuven/Notebook/Wiki]]
+
{{Team:KULeuven/EditableTemplateH3|Blue Light Receptor|{{PAGENAME}}/BlueLightReceptor}}
-
[[Category:Team:KULeuven/Notebook/Links]]
+
{{Team:KULeuven/EditableTemplateH3|Vanillin Production|{{PAGENAME}}/VanillinProduction}}
-
[[Category:Team:KULeuven/BioBricks/BBa_J58105]]
+
{{Team:KULeuven/EditableTemplateH3|Vanillin Receptor|{{PAGENAME}}/VanillinReceptor}}
-
[[Category:Team:KULeuven/BioBricks/BBa_J58104]]
+
{{Team:KULeuven/EditableTemplateH3|Key/Lock/Anti-Key|{{PAGENAME}}/KeyLockAntiKey}}
 +
{{Team:KULeuven/Common2/PageFooter}}

Latest revision as of 08:36, 10 September 2009

Contents

Project progress

A & B (comparator), ideas

Key/lock system, see [http://parts2.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Riboregulators (Berkeley 2006)]

Odor synthesis/sensor

  • Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
    • Combination of 5 genes; 3 are available
    • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp

Light sensor

  • YcgF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of YcgF gene for expression
  • Probable strain K12
  • Primer of YcgF Promotor:
    • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])

Odourless strain of E.coli

  • [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline deficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
  • Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'

To do

  • Blue light receptor
    • Decide on E.Coli strain
      • Try with K12
      • Vector in neural scent (indole knockout)
    • Decide on primers (!Pre + suffix!)
    • PCR of promotor
    • Couple promotor to GFP --> Standard iGEM plasmid
    • Test!
    • Obtain regulation site
  • Vanillin synthesis
    • Send mail to University of Tuscia
  • Presentations
  • Order receptor biobrick
    • Trg - Env2
    • PBP

Drylab

[http://www.kuleuven.be/rega/mvr/bookmarktsdl.html BioInformatics bookmarks]

Wiki

  • Create Ideas page
  • Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki


Progress of parts

[edit] Blue Light Receptor

  • YcgF Gene, naturally available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
  • Probable strain K12
  • Promotor voor YcgF gene:
    • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
      (source: [http://www.ncbi.nlm.nih.gov])

[edit] Vanillin Production

  • Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
    • Combination of 5 genes; 3 are available
    • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferulic accid --> Vanillin, 5k bp

[edit] Vanillin Receptor

[edit] Key/Lock/Anti-Key