Team:KULeuven/13 July 2009
From 2009.igem.org
(Difference between revisions)
(→To do) |
|||
(8 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
- | {{Team:KULeuven/ | + | {{Team:KULeuven/Common2/BeginHeader}} |
- | {{Team:KULeuven/Common/ | + | {{Team:KULeuven/Common/SubMenu_Notebook}} |
- | {{Team:KULeuven/ | + | {{Team:KULeuven/Common2/EndHeader}} |
{{Team:KULeuven/Notebook/DayNavigator}} | {{Team:KULeuven/Notebook/DayNavigator}} | ||
Line 11: | Line 11: | ||
==Odor synthesis/sensor== | ==Odor synthesis/sensor== | ||
* Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140] | * Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140] | ||
- | **Combination of 5 genes; 3 | + | **Combination of 5 genes; 3 are available |
- | ***[ | + | ***[https://2007.igem.org/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthesis pathway by Edinburgh igem 2007) |
** [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp | ** [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp | ||
==Light sensor== | ==Light sensor== | ||
- | * | + | *''YcgF'' Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of ''YcgF'' gene for expression |
*Probable strain K12 | *Probable strain K12 | ||
- | *Promotor | + | * Primer of YcgF Promotor: |
**AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGC'''ATG''' (bron: [www.ncbi.nlm.nih.gov]) | **AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGC'''ATG''' (bron: [www.ncbi.nlm.nih.gov]) | ||
- | == | + | ==Odourless strain of ''E.coli''== |
- | * [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline | + | * [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline deficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912]. |
* Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.' | * Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.' | ||
=To do= | =To do= | ||
* Blue light receptor | * Blue light receptor | ||
- | ** Decide on E.Coli strain | + | ** Decide on ''E.Coli'' strain |
- | *** | + | ***Try with K12 |
***Vector in neural scent (indole knockout) | ***Vector in neural scent (indole knockout) | ||
**Decide on primers (!Pre + suffix!) | **Decide on primers (!Pre + suffix!) | ||
**PCR of promotor | **PCR of promotor | ||
**Couple promotor to GFP --> Standard iGEM plasmid | **Couple promotor to GFP --> Standard iGEM plasmid | ||
- | ** | + | **Test! |
**Obtain regulation site | **Obtain regulation site | ||
*Vanillin synthesis | *Vanillin synthesis | ||
Line 39: | Line 39: | ||
*Presentations | *Presentations | ||
*Order receptor biobrick | *Order receptor biobrick | ||
- | ** | + | ** {{kulpart|BBa_J58105}} |
- | ** Trg - Env2 | + | ** Trg - Env2 {{kulpart|BBa_J58104}} |
**PBP | **PBP | ||
Line 48: | Line 48: | ||
== Wiki == | == Wiki == | ||
- | * | + | * Create [[Team:KULeuven/Ideas|Ideas]] page |
* Some idiot replaced the example logo [[:Image:Example_logo.png]] with his own logo, so all references to it were removed from our wiki | * Some idiot replaced the example logo [[:Image:Example_logo.png]] with his own logo, so all references to it were removed from our wiki | ||
[[Category:Team:KULeuven/Notebook/Wiki]] | [[Category:Team:KULeuven/Notebook/Wiki]] | ||
[[Category:Team:KULeuven/Notebook/Links]] | [[Category:Team:KULeuven/Notebook/Links]] | ||
- | + | ||
- | + | ||
- | + | <!-- Don't edit below this line --> | |
+ | __NOEDITSECTION__ | ||
+ | = Progress of parts = | ||
+ | {{Team:KULeuven/EditableTemplateH3|Blue Light Receptor|{{PAGENAME}}/BlueLightReceptor}} | ||
+ | {{Team:KULeuven/EditableTemplateH3|Vanillin Production|{{PAGENAME}}/VanillinProduction}} | ||
+ | {{Team:KULeuven/EditableTemplateH3|Vanillin Receptor|{{PAGENAME}}/VanillinReceptor}} | ||
+ | {{Team:KULeuven/EditableTemplateH3|Key/Lock/Anti-Key|{{PAGENAME}}/KeyLockAntiKey}} | ||
+ | {{Team:KULeuven/Common2/PageFooter}} |
Latest revision as of 08:36, 10 September 2009
Contents |
Project progress
A & B (comparator), ideas
Key/lock system, see [http://parts2.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Riboregulators (Berkeley 2006)]
Odor synthesis/sensor
- Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
- Combination of 5 genes; 3 are available
- Edinburgh Vanilla production (Synthesis pathway by Edinburgh igem 2007)
- [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp
- Combination of 5 genes; 3 are available
Light sensor
- YcgF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of YcgF gene for expression
- Probable strain K12
- Primer of YcgF Promotor:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])
Odourless strain of E.coli
- [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline deficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
- Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'
To do
- Blue light receptor
- Decide on E.Coli strain
- Try with K12
- Vector in neural scent (indole knockout)
- Decide on primers (!Pre + suffix!)
- PCR of promotor
- Couple promotor to GFP --> Standard iGEM plasmid
- Test!
- Obtain regulation site
- Decide on E.Coli strain
- Vanillin synthesis
- Send mail to University of Tuscia
- Presentations
- Order receptor biobrick
- Trg - Env2
- PBP
Drylab
[http://www.kuleuven.be/rega/mvr/bookmarktsdl.html BioInformatics bookmarks]
Wiki
- Create Ideas page
- Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki
Progress of parts
[edit] Blue Light Receptor
- YcgF Gene, naturally available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
- Probable strain K12
- Promotor voor YcgF gene:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
(source: [http://www.ncbi.nlm.nih.gov])
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG
[edit] Vanillin Production
- Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
- Combination of 5 genes; 3 are available
- Edinburgh Vanilla production (Pathway synthesis, Edinburgh iGEM 2007)
- [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferulic accid --> Vanillin, 5k bp
- Combination of 5 genes; 3 are available