Team:EPF-Lausanne/Notebook

From 2009.igem.org

(Difference between revisions)
(07.07.09)
 
(158 intermediate revisions not shown)
Line 1: Line 1:
{{EPF-Lausanne09}}
{{EPF-Lausanne09}}
<div CLASS="epfltrick">__TOC__
<div CLASS="epfltrick">__TOC__
-
</div><div CLASS="epfl09">
+
</div><div CLASS="epfl09lab">
-
=Notebook=
+
<html><br><br><br><br><br><br><br><center>
-
===06.07.09===
+
<font size="12" color="#007CBC">Notebook</font>
-
;Wet lab:
+
</center></html>
-
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
+
<br>
-
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
+
<br>
-
LOVTAP is in a plasmid called pCal-n (see picture below):
+
<FONT face="arial">
 +
<p align="center"><big>'''{{CURRENTDAY}}.{{CURRENTMONTH}}.{{CURRENTYEAR}} | {{CURRENTTIME}}'''</big></p></FONT>
-
[[Image: pCAL-n.jpg|500px|thumb|center|pCal-n plasmid]]
 
-
<br>Some comments on the plasmid:
+
==Calendar==
-
<br>-CBP is a small peptide with which we could purify LOVTAP protein
+
-
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
+
 +
<center><table valign=top>
 +
<tr valign=top>
 +
<td valign=top>{{ #calendar: title=EPF-Lausanne |year=2009 | month=06 }}
 +
</td>
 +
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=07 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=08 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=09 }}
 +
</td>
 +
<td valign=top>
 +
{{ #calendar: title=EPF-Lausanne |year=2009 | month=10 }}
 +
</td>
 +
</tr>
 +
</table></center>
-
;Cloning strategy:
+
<!--<html>
-
Four forward primers were designed to amplify:
+
<iframe src="http://www.google.com/calendar/embed?title=EPFL Planning &amp;height=600&amp;wkst=1&amp;bgcolor=%23FFFFFF&amp;src=igem.epfl.09%40gmail.com&amp;color=%23A32929&amp;ctz=Europe%2FRome" style=" border-width:0 " width="800" height="600" frameborder="0" scrolling="no"></iframe>
-
<br> 1.Promoter T7, RBS, CBP and LOVTAP:
+
</html>
-
:gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
+
-
2.RBS, CBP and LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
+
-
3.CBP and LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
+
-
4.LOVTAP:
+
-
:gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
+
-
One reverse primer were designed:
+
-
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
+
-
 
+
-
 
+
-
The '''recipient IGEM backbone''' have been chosen: [http://partsregistry.org/Part:pSB3C5 pSB3C5], well 5G in the received kit plate 1
+
-
 
+
-
;People in the lab: Tu, Heidi, Rafael, Basile, Nath
+
-
 
+
-
 
+
-
===07.07.09===
+
-
 
+
-
;Remark for the notebook:
+
-
First, it's great you already started to use the wiki and customised the menu!<br> Then I think we should add the name of the peoples who worked on each part of a process (or at least present the same day). It would allow easy team transitions.<br>
+
-
For the wiki in general, as you did in this page, it is much better not to use html tags.<br>
+
-
We will have a meeting for the modeling on tuesday, I will come to the lab before.<br><br>
+
-
;Wet lab:
+
-
 
+
-
We have to grow the 3 strains generously sent by ([mailto:j.beatty@ubc.ca Tom Beatty])
+
-
 
+
-
The three strains are :
+
-
:*''R.Palustris'' CEA001 (wild type) ; should be grown on LB medium only
+
-
:*''R.Palustris'' BPHP1+ ; should be grown on LB with gentamycin (100 micrograms/ml)
+
-
:*''E.Coli'' DH10B (pBPH/hmu0) ; should be grown on LB with gentamycin (20 micorgrams/ml)
+
-
 
+
-
 
+
-
The transformed LOVTAP and TrpR worked well (N.B. the plasmid of TrpR is pUC19 so the antibiotic resistance is Amp -> see below)
+
-
 
+
-
 
+
-
 
+
-
[[Image: RTEmagicC_puc19_2.gif.gif|500px|thumb|center|pUC19 plasmid]]
+
-
 
+
-
 
+
-
We did the glycerol stock
+
-
 
+
-
'''People in the lab'''
+
-
:Tu, Rafael, Nath, Heidi, Basile
+
-
 
+
-
 
+
-
;Cloning strategy:
+
-
 
+
-
{| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
-
!align="center"|[[Team:EPF-Lausanne|Home]]
+
-
!align="center"|[[Team:EPF-Lausanne/Team|The Team]]
+
-
!align="center"|[[Team:EPF-Lausanne/Project|The Project]]
+
-
!align="center"|[[Team:EPF-Lausanne/Parts|Parts Submitted to the Registry]]
+
-
!align="center"|[[Team:EPF-Lausanne/Modeling|Modeling]]
+
-
!align="center"|[[Team:EPF-Lausanne/Notebook|Notebook]]
+
-
!align="center"|[[Team:EPF-Lausanne/Lectures|Lectures]]
+
-
!align="center"|[[Team:EPF-Lausanne/Team Management|Team Management]]
+
-
!align="center"|[[Team:EPF-Lausanne/References|References]]
+
-
 
+
-
|}
+
 +
<html>
 +
<p align="center" class="style1"><a href="#top"><img src="https://static.igem.org/mediawiki/2009/thumb/0/06/Up_arrow.png/50px-Up_arrow.png" alt="Back to top" border="0"></a><br></p>
 +
</html>
 +
<br>-->
</div><div CLASS="epfl09bouchon"></div>
</div><div CLASS="epfl09bouchon"></div>

Latest revision as of 18:24, 20 October 2009

Contents








Notebook


3.12.2024 | 19:36


Calendar

           
June
MTWTFSS
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/1_June_2009&action=edit 1] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/2_June_2009&action=edit 2] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/3_June_2009&action=edit 3] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/4_June_2009&action=edit 4] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/5_June_2009&action=edit 5] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/6_June_2009&action=edit 6] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/7_June_2009&action=edit 7]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/8_June_2009&action=edit 8] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/9_June_2009&action=edit 9] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/10_June_2009&action=edit 10] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/11_June_2009&action=edit 11] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/12_June_2009&action=edit 12] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/13_June_2009&action=edit 13] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/14_June_2009&action=edit 14]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/15_June_2009&action=edit 15] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/16_June_2009&action=edit 16] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/17_June_2009&action=edit 17] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/18_June_2009&action=edit 18] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/19_June_2009&action=edit 19] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/20_June_2009&action=edit 20] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/21_June_2009&action=edit 21]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/22_June_2009&action=edit 22] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/23_June_2009&action=edit 23] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/24_June_2009&action=edit 24] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/25_June_2009&action=edit 25] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/26_June_2009&action=edit 26] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/27_June_2009&action=edit 27] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/28_June_2009&action=edit 28]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/29_June_2009&action=edit 29] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/30_June_2009&action=edit 30]
July
MTWTFSS
    [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/1_July_2009&action=edit 1] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/2_July_2009&action=edit 2] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/3_July_2009&action=edit 3] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/4_July_2009&action=edit 4] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/5_July_2009&action=edit 5]
[http://2009.igem.org/EPF-Lausanne/6_July_2009 6] [http://2009.igem.org/EPF-Lausanne/7_July_2009 7] [http://2009.igem.org/EPF-Lausanne/8_July_2009 8] [http://2009.igem.org/EPF-Lausanne/9_July_2009 9] [http://2009.igem.org/EPF-Lausanne/10_July_2009 10] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/11_July_2009&action=edit 11] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/12_July_2009&action=edit 12]
[http://2009.igem.org/EPF-Lausanne/13_July_2009 13] [http://2009.igem.org/EPF-Lausanne/14_July_2009 14] [http://2009.igem.org/EPF-Lausanne/15_July_2009 15] [http://2009.igem.org/EPF-Lausanne/16_July_2009 16] [http://2009.igem.org/EPF-Lausanne/17_July_2009 17] [http://2009.igem.org/EPF-Lausanne/18_July_2009 18] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/19_July_2009&action=edit 19]
[http://2009.igem.org/EPF-Lausanne/20_July_2009 20] [http://2009.igem.org/EPF-Lausanne/21_July_2009 21] [http://2009.igem.org/EPF-Lausanne/22_July_2009 22] [http://2009.igem.org/EPF-Lausanne/23_July_2009 23] [http://2009.igem.org/EPF-Lausanne/24_July_2009 24] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/25_July_2009&action=edit 25] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/26_July_2009&action=edit 26]
[http://2009.igem.org/EPF-Lausanne/27_July_2009 27] [http://2009.igem.org/EPF-Lausanne/28_July_2009 28] [http://2009.igem.org/EPF-Lausanne/29_July_2009 29] [http://2009.igem.org/EPF-Lausanne/30_July_2009 30] [http://2009.igem.org/EPF-Lausanne/31_July_2009 31]
August
MTWTFSS
          [http://2009.igem.org/EPF-Lausanne/1_August_2009 1] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/2_August_2009&action=edit 2]
[http://2009.igem.org/EPF-Lausanne/3_August_2009 3] [http://2009.igem.org/EPF-Lausanne/4_August_2009 4] [http://2009.igem.org/EPF-Lausanne/5_August_2009 5] [http://2009.igem.org/EPF-Lausanne/6_August_2009 6] [http://2009.igem.org/EPF-Lausanne/7_August_2009 7] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/8_August_2009&action=edit 8] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/9_August_2009&action=edit 9]
[http://2009.igem.org/EPF-Lausanne/10_August_2009 10] [http://2009.igem.org/EPF-Lausanne/11_August_2009 11] [http://2009.igem.org/EPF-Lausanne/12_August_2009 12] [http://2009.igem.org/EPF-Lausanne/13_August_2009 13] [http://2009.igem.org/EPF-Lausanne/14_August_2009 14] [http://2009.igem.org/EPF-Lausanne/15_August_2009 15] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/16_August_2009&action=edit 16]
[http://2009.igem.org/EPF-Lausanne/17_August_2009 17] [http://2009.igem.org/EPF-Lausanne/18_August_2009 18] [http://2009.igem.org/EPF-Lausanne/19_August_2009 19] [http://2009.igem.org/EPF-Lausanne/20_August_2009 20] [http://2009.igem.org/EPF-Lausanne/21_August_2009 21] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/22_August_2009&action=edit 22] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/23_August_2009&action=edit 23]
[http://2009.igem.org/EPF-Lausanne/24_August_2009 24] [http://2009.igem.org/EPF-Lausanne/25_August_2009 25] [http://2009.igem.org/EPF-Lausanne/26_August_2009 26] [http://2009.igem.org/EPF-Lausanne/27_August_2009 27] [http://2009.igem.org/EPF-Lausanne/28_August_2009 28] [http://2009.igem.org/EPF-Lausanne/29_August_2009 29] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/30_August_2009&action=edit 30]
[http://2009.igem.org/EPF-Lausanne/31_August_2009 31]
September
MTWTFSS
  [http://2009.igem.org/EPF-Lausanne/1_September_2009 1] [http://2009.igem.org/EPF-Lausanne/2_September_2009 2] [http://2009.igem.org/EPF-Lausanne/3_September_2009 3] [http://2009.igem.org/EPF-Lausanne/4_September_2009 4] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/5_September_2009&action=edit 5] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/6_September_2009&action=edit 6]
[http://2009.igem.org/EPF-Lausanne/7_September_2009 7] [http://2009.igem.org/EPF-Lausanne/8_September_2009 8] [http://2009.igem.org/EPF-Lausanne/9_September_2009 9] [http://2009.igem.org/EPF-Lausanne/10_September_2009 10] [http://2009.igem.org/EPF-Lausanne/11_September_2009 11] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/12_September_2009&action=edit 12] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/13_September_2009&action=edit 13]
[http://2009.igem.org/EPF-Lausanne/14_September_2009 14] [http://2009.igem.org/EPF-Lausanne/15_September_2009 15] [http://2009.igem.org/EPF-Lausanne/16_September_2009 16] [http://2009.igem.org/EPF-Lausanne/17_September_2009 17] [http://2009.igem.org/EPF-Lausanne/18_September_2009 18] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/19_September_2009&action=edit 19] [http://2009.igem.org/EPF-Lausanne/20_September_2009 20]
[http://2009.igem.org/EPF-Lausanne/21_September_2009 21] [http://2009.igem.org/EPF-Lausanne/22_September_2009 22] [http://2009.igem.org/EPF-Lausanne/23_September_2009 23] [http://2009.igem.org/EPF-Lausanne/24_September_2009 24] [http://2009.igem.org/EPF-Lausanne/25_September_2009 25] [http://2009.igem.org/EPF-Lausanne/26_September_2009 26] [http://2009.igem.org/EPF-Lausanne/27_September_2009 27]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/28_September_2009&action=edit 28] [http://2009.igem.org/EPF-Lausanne/29_September_2009 29] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/30_September_2009&action=edit 30]
October
MTWTFSS
      [http://2009.igem.org/EPF-Lausanne/1_October_2009 1] [http://2009.igem.org/EPF-Lausanne/2_October_2009 2] [http://2009.igem.org/EPF-Lausanne/3_October_2009 3] [http://2009.igem.org/EPF-Lausanne/4_October_2009 4]
[http://2009.igem.org/EPF-Lausanne/5_October_2009 5] [http://2009.igem.org/EPF-Lausanne/6_October_2009 6] [http://2009.igem.org/EPF-Lausanne/7_October_2009 7] [http://2009.igem.org/EPF-Lausanne/8_October_2009 8] [http://2009.igem.org/EPF-Lausanne/9_October_2009 9] [http://2009.igem.org/EPF-Lausanne/10_October_2009 10] [http://2009.igem.org/EPF-Lausanne/11_October_2009 11]
[http://2009.igem.org/EPF-Lausanne/12_October_2009 12] [http://2009.igem.org/EPF-Lausanne/13_October_2009 13] [http://2009.igem.org/EPF-Lausanne/14_October_2009 14] [http://2009.igem.org/EPF-Lausanne/15_October_2009 15] [http://2009.igem.org/EPF-Lausanne/16_October_2009 16] [http://2009.igem.org/EPF-Lausanne/17_October_2009 17] [http://2009.igem.org/EPF-Lausanne/18_October_2009 18]
[http://2009.igem.org/EPF-Lausanne/19_October_2009 19] [http://2009.igem.org/EPF-Lausanne/20_October_2009 20] [http://2009.igem.org/EPF-Lausanne/21_October_2009 21] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/22_October_2009&action=edit 22] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/23_October_2009&action=edit 23] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/24_October_2009&action=edit 24] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/25_October_2009&action=edit 25]
[http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/26_October_2009&action=edit 26] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/27_October_2009&action=edit 27] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/28_October_2009&action=edit 28] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/29_October_2009&action=edit 29] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/30_October_2009&action=edit 30] [http://2009.igem.org/wiki/index.php?title=EPF-Lausanne/31_October_2009&action=edit 31]