Team:Valencia/Notebook/September

From 2009.igem.org

(Difference between revisions)
 
(37 intermediate revisions not shown)
Line 1: Line 1:
-
__NOTOC__
+
{{Template:Valencia09iGEM23}}
-
{{Template:Valencia09iGEM}}
+
<html>
-
 
+
<style>
 +
#content{
 +
          height: 4300px;
 +
        }
 +
</style>
 +
</html>
 +
<br>
<div align="center">
<div align="center">
{|
{|
Line 83: Line 89:
| <Font Color="#c0c0c0">27</Font> || <Font Color="#c0c0c0">28</Font> || <Font Color="#c0c0c0">29</Font> || &nbsp;<Font Color="#c0c0c0">30</Font> || <Font Color="#c0c0c0">31</Font> || &nbsp;1 || &nbsp;2   
| <Font Color="#c0c0c0">27</Font> || <Font Color="#c0c0c0">28</Font> || <Font Color="#c0c0c0">29</Font> || &nbsp;<Font Color="#c0c0c0">30</Font> || <Font Color="#c0c0c0">31</Font> || &nbsp;1 || &nbsp;2   
|-
|-
-
| &nbsp;3 ||&nbsp;4 || &nbsp;5 || &nbsp;&nbsp;6 || &nbsp;7 || &nbsp;8 || &nbsp;9  
+
| &nbsp;[[Team:Valencia/Notebook/August#August 3rd|3]] || &nbsp;[[Team:Valencia/Notebook/August#August 4th|4]] || &nbsp;[[Team:Valencia/Notebook/August#August 5th|5]] || &nbsp;[[Team:Valencia/Notebook/August#August 6th|6]] || &nbsp;[[Team:Valencia/Notebook/August#August 7th|7]] || &nbsp;8 || &nbsp;9  
|-
|-
-
| 10 || 11 || 12 || &nbsp;13|| 14|| 15 || 16
+
| [[Team:Valencia/Notebook/August#August 10th|10]] || [[Team:Valencia/Notebook/August#August 11th|11]] || [[Team:Valencia/Notebook/August#August 12th|12]] || [[Team:Valencia/Notebook/August#August 13th|13]] || [[Team:Valencia/Notebook/August#August 14th|14]] || 15 || 16
|-
|-
-
|17|| 18 || 19 || &nbsp;20 || 21 || 22 || 23
+
|[[Team:Valencia/Notebook/August#August 17th|17]] || [[Team:Valencia/Notebook/August#August 18th|18]] || [[Team:Valencia/Notebook/August#August 19th|19]] || [[Team:Valencia/Notebook/August#August 20th|20]] || [[Team:Valencia/Notebook/August#August 21st|21]] || 22 || 23
|-
|-
-
| 24||25 || 26 || &nbsp;27 || 28 || 29 || 30
+
| [[Team:Valencia/Notebook/August#August 24th|24]] || [[Team:Valencia/Notebook/August#August 25th|25]] || [[Team:Valencia/Notebook/August#August 26th|26]] || 27 || 28 || 29 || 30
|-
|-
-
|31||<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font> || <Font Color="#c0c0c0">5</Font> || <Font Color="#c0c0c0">6</Font>
+
|31 ||<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font> || <Font Color="#c0c0c0">5</Font> || <Font Color="#c0c0c0">6</Font>
|}
|}
|| || valign="top" |  
|| || valign="top" |  
Line 100: Line 106:
| Mo || Tu || We || Th || Fr || Sa || <Font Color="#FF0000">Su</Font>
| Mo || Tu || We || Th || Fr || Sa || <Font Color="#FF0000">Su</Font>
|-
|-
-
| <Font Color="#c0c0c0">31</Font>|| &nbsp;1 || &nbsp;2 || &nbsp;3 || &nbsp;4 || &nbsp;5 || &nbsp;6 ||  
+
| <Font Color="#c0c0c0">31</Font>|| &nbsp;1 || &nbsp;2 || &nbsp;3 || &nbsp;[[Team:Valencia/Notebook/September#September 4th|4]] || &nbsp;5 || &nbsp;6 ||  
|-
|-
-
| &nbsp;7 || &nbsp;8 || &nbsp;9 || 10 || [[Team:Valencia/Notebook/September#September 11|11]] || 12 || 13 ||  
+
| &nbsp;7 || &nbsp;8 || &nbsp;9 || 10 || [[Team:Valencia/Notebook/September#September 11th|11]] || 12 || 13 ||  
|-
|-
-
| 14 || 15 || 16 || 17 || 18 || 19 || 20 ||  
+
| [[Team:Valencia/Notebook/September#September 14th|14]] || [[Team:Valencia/Notebook/September#September 15th|15]] || [[Team:Valencia/Notebook/September#September 16th|16]] || [[Team:Valencia/Notebook/September#September 17th|17]] || [[Team:Valencia/Notebook/September#September 18th|18]]  || 19 || 20 ||  
|-
|-
-
| 21 || 22 || 23 || 24 || 25 || 26 || 27 ||  
+
| [[Team:Valencia/Notebook/September#September 21th|21]]  || [[Team:Valencia/Notebook/September#September 22th|22]]  || 23 || 24 || 25 || 26 || 27 ||  
|-
|-
| 28 || 29 || 30 || &nbsp;<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font>  
| 28 || 29 || 30 || &nbsp;<Font Color="#c0c0c0">1</Font> || <Font Color="#c0c0c0">2</Font> || <Font Color="#c0c0c0">3</Font> || <Font Color="#c0c0c0">4</Font>  
Line 148: Line 154:
|}
|}
</div>
</div>
-
<div style=" width:94%; margin: 0 auto;">
+
 
<!-- ESCRIBIR AQUI -->
<!-- ESCRIBIR AQUI -->
-
===September 11===
 
-
- Team meeting
 
 +
===September 4th===
 +
 +
We have tried our protocol using the fluoriscense microscope.We obtained some interesting results, but finally they were only artifacts. It seems like the the microscope is a good option to "see" our yeasts.
 +
 +
 +
===September 11th===
 +
 +
 +
Today we have had an iGEM meeting.
 +
 +
 +
We have repited the PCR with new primers:
 +
 +
 +
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’
 +
 +
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’
 +
 +
 +
'''Programme'''
 +
 +
<div style="position:relative; margin-left:175px;">
 +
After 2 minutes at 94 ºC as a previous step. Every of our 30 cycles has these three steps:
 +
 +
- 45s at 94ºC
 +
 +
- 1min at 60º
 +
 +
- 1min at 72ºC
 +
 +
 +
1 = wt (1 microlitre)
 +
 +
2 = wt (2 microlitres)
 +
 +
3 = Cch1 (1 microlitre)
 +
 +
4 = Mid1 (1 microlitre)
 +
 +
5 = Negative Control
 +
 +
6 = Possitive Control
 +
 +
(We used the same MWM)
 +
 +
 +
We haven't obtained any result.
 +
 +
 +
===September 14th===
 +
 +
 +
Trying another PCR...
 +
 +
 +
We have variated the programme another time T-T
 +
 +
 +
'''Programme'''
 +
 +
 +
After 3 minutes at 94 ºC as a previous step. Every of our 30 cycles has these trhee steps:
 +
 +
- 30s at 94ºC
 +
 +
- 1min at 55ºC
 +
 +
- 1min at 72ºC
 +
 +
We have added a final step of 7 minutes at 72ºC.
 +
 +
 +
1 = wt (1 microlitre)
 +
 +
2 = wt (2 microlitres)
 +
 +
3 = Cch1 (1 microlitre)
 +
 +
4 = Mid1 (1 microlitre)
 +
 +
5 = Negative Control
 +
 +
6 = Possitive Control
 +
 +
(We used the same MWM)
 +
 +
 +
[[Image:Gelaeq.JPG]]
 +
 +
 +
Wiiiiiiiiiiiiiiiii!!!!!!!!! We had amplification!!!!! We will use wt 1 microlitre of PCR amplification product (career 1) to build our first BioBrick in the next days.
 +
 +
 +
 +
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input. We didn't obtain any result.
 +
 +
===15th September===
 +
 +
 +
We have started with bacteria transformation. To build our first BioBrick, we selected the pSB1A3 plasmid located at 1K hole of plate 1 (distributed for the iGEM at spring 2009). We have used a E.coli strain ultracompetent called XL1-Gold. Transformation protocol comes with the strain.
 +
 +
After the steps, we left our strain in incubation, to make them add the plasmid.
 +
 +
 
 +
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input.
 +
 +
 +
===16th September===
 +
 +
 +
Our E.coli are transformed. We have a lot of colonies in the 300 microliters spreading culture. They are red.
 +
 +
We have repited another time Arinyo's protocol.
 +
 +
 +
===17th September===
 +
 +
 +
We couldn't reproduce this time Arinyo's protocol because the preculture didn't grow up.
 +
 +
For other side, we have prepared a preculture of E.coli transformed to do a plasmidic DNA extraccion the following day.
 +
 +
 +
===18th September===
 +
 +
 +
... And another Arinyo's protocol reproduction... Neverending story... :D
 +
 +
 +
 +
===21th September===
 +
 +
 +
We have done different things today.
 +
 +
First, we have continued with Arinyo's protocol reproductions.
 +
 +
Second, we have made the plasmidic DNA extraction.
 +
 +
And third, we have prepared new SD medium and SD laking Leu (líquid and with agar).
 +
 +
 +
===22th September===
 +
 +
 +
Another Arinyo's protocol reproduction... What a novelty!!!
 +
 +
 +
 +
===24th September===
 +
 +
iGEM meeting and... Dinner&beers!!! What do you think? Scientists don't get fun? ;)
 +
 +
 +
 +
===25th September===
 +
 +
We have continued with BioBricks tasks: today we have made a digestion. Both extraction product (plasmids) and PCR product (insert) has been digested with EcoRI and XbaI in those quantities:<br>
 +
- H20<br>
 +
- H Buffer<br>
 +
- 0,5 microliters XbaI<br>
 +
- 0,5 microliters EcoRI<br>
 +
- plasmid<br>
 +
 +
... And for other side...<br>
-
<br><br><br><br><br><br><br><br><br><br>
+
- H20<br>
 +
- H Buffer<br>
 +
- 0,5 microliters XbaI<br>
 +
- 0,5 microliters EcoRI<br>
 +
- insert<br>
<center><html>
<center><html>
-
<div style=" width:50%;">
+
<div style=" width:80%;">
<h2>
<h2>
-
Back to<a href="https://2009.igem.org/Team:Valencia/Notebook/July"><font color="#047DB5"> July </font></a>&nbsp;&nbsp;&nbsp;| &nbsp;&nbsp;&nbsp;August &nbsp;&nbsp;&nbsp;| &nbsp;&nbsp;&nbsp;Go to <a href="https://2009.igem.org/Team:Valencia/Notebook/September"><font color="#047DB5"> September </font></a></h2>
+
Back to<a href="https://2009.igem.org/Team:Valencia/Notebook/August"><font color="#047DB5"> August </font></a>&nbsp;&nbsp;&nbsp;| &nbsp;&nbsp;&nbsp;September &nbsp;&nbsp;&nbsp;| &nbsp;&nbsp;&nbsp;Go to <a href="https://2009.igem.org/Team:Valencia/Notebook/October"><font color="#047DB5"> October </font></a></h2>
</div>
</div>
</html></center>
</html></center>
</div>
</div>

Latest revision as of 19:02, 27 November 2009



April
Mo Tu We Th Fr Sa Su
30 31  1  2  3  4  5
 6  7  8  9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30  1  2  3
May
Mo Tu We Th Fr Sa Su
27 28 29 30  1  2  3
 4  5  6  7  8  9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31
June
Mo Tu We Th Fr Sa Su
 1  2  3  4  5  6  7
 8  9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30  1   2  3  4  5
July
Mo Tu We Th Fr Sa Su
29 30  1  2  3  4  5
 6 7  8  9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31   1  2
August
Mo Tu We Th Fr Sa Su
27 28 29  30 31  1  2
 3  4  5  6  7  8  9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31 1 2 3 4 5 6
September
Mo Tu We Th Fr Sa Su
31  1  2  3  4  5  6
 7  8  9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30  1 2 3 4
October
Mo Tu We Th Fr Sa Su
28 29 30   1  2  3  4
 5  6  7  8  9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30 31  1
November
Mo Tu We Th Fr Sa Su
26 27 28  29 30 31  1
 2  3  4  5  6  7  8
 9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30  1  2  3  4  5  6


September 4th

We have tried our protocol using the fluoriscense microscope.We obtained some interesting results, but finally they were only artifacts. It seems like the the microscope is a good option to "see" our yeasts.


September 11th

Today we have had an iGEM meeting.


We have repited the PCR with new primers:


Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’

Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’


Programme

After 2 minutes at 94 ºC as a previous step. Every of our 30 cycles has these three steps:

- 45s at 94ºC

- 1min at 60º

- 1min at 72ºC


1 = wt (1 microlitre)

2 = wt (2 microlitres)

3 = Cch1 (1 microlitre)

4 = Mid1 (1 microlitre)

5 = Negative Control

6 = Possitive Control

(We used the same MWM)


We haven't obtained any result.


September 14th

Trying another PCR...


We have variated the programme another time T-T


Programme


After 3 minutes at 94 ºC as a previous step. Every of our 30 cycles has these trhee steps:

- 30s at 94ºC

- 1min at 55ºC

- 1min at 72ºC

We have added a final step of 7 minutes at 72ºC.


1 = wt (1 microlitre)

2 = wt (2 microlitres)

3 = Cch1 (1 microlitre)

4 = Mid1 (1 microlitre)

5 = Negative Control

6 = Possitive Control

(We used the same MWM)


Gelaeq.JPG


Wiiiiiiiiiiiiiiiii!!!!!!!!! We had amplification!!!!! We will use wt 1 microlitre of PCR amplification product (career 1) to build our first BioBrick in the next days.


For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input. We didn't obtain any result.

15th September

We have started with bacteria transformation. To build our first BioBrick, we selected the pSB1A3 plasmid located at 1K hole of plate 1 (distributed for the iGEM at spring 2009). We have used a E.coli strain ultracompetent called XL1-Gold. Transformation protocol comes with the strain.

After the steps, we left our strain in incubation, to make them add the plasmid.


For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input.


16th September

Our E.coli are transformed. We have a lot of colonies in the 300 microliters spreading culture. They are red.

We have repited another time Arinyo's protocol.


17th September

We couldn't reproduce this time Arinyo's protocol because the preculture didn't grow up.

For other side, we have prepared a preculture of E.coli transformed to do a plasmidic DNA extraccion the following day.


18th September

... And another Arinyo's protocol reproduction... Neverending story... :D


21th September

We have done different things today.

First, we have continued with Arinyo's protocol reproductions.

Second, we have made the plasmidic DNA extraction.

And third, we have prepared new SD medium and SD laking Leu (líquid and with agar).


22th September

Another Arinyo's protocol reproduction... What a novelty!!!


24th September

iGEM meeting and... Dinner&beers!!! What do you think? Scientists don't get fun? ;)


25th September

We have continued with BioBricks tasks: today we have made a digestion. Both extraction product (plasmids) and PCR product (insert) has been digested with EcoRI and XbaI in those quantities:
- H20
- H Buffer
- 0,5 microliters XbaI
- 0,5 microliters EcoRI
- plasmid

... And for other side...

- H20
- H Buffer
- 0,5 microliters XbaI
- 0,5 microliters EcoRI
- insert


Back to August    |    September    |    Go to October

Retrieved from "http://2009.igem.org/Team:Valencia/Notebook/September"