Team:Todai-Tokyo/Protocols/Notebook Sample
From 2009.igem.org
(Difference between revisions)
Line 18: | Line 18: | ||
The yqiT gene was [[Team:Todai-Tokyo/Protocols/PCR|PCR]] amplified from pLacI-yqiT-dterm ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/7) using the following primers: | The yqiT gene was [[Team:Todai-Tokyo/Protocols/PCR|PCR]] amplified from pLacI-yqiT-dterm ([[Team:Todai-Tokyo/Protocols/Miniprep|miniprep]]ped on 9/7) using the following primers: | ||
- | yqiT fwd: | + | '''yqiT fwd''': agcccgtgtagtactgtagagtt <BR> |
- | yqiT rev: agggatgtttgccagtcgtaattag | + | '''yqiT rev''': agggatgtttgccagtcgtaattag <BR> |
- | + | using [[Team:Todai-Tokyo/Protocols/PCR/programs|PCR program 1]] and [[Team:Todai-Tokyo/Protocols/PCR/Enzymes|Ex-taq]]. | |
+ | |||
+ | This PCR reaction attaches a Biobrick prefix and suffix to the gene. | ||
<h2> Sequencing </h2> | <h2> Sequencing </h2> | ||
+ | |||
+ | |||
<h2> Transformation </h2> | <h2> Transformation </h2> | ||
<h2> Ligation </h2> | <h2> Ligation </h2> |
Revision as of 02:43, 20 October 2009
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Protocols | Ethics |
---|
MiniprepThe following were miniprepped:
PCRThe yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers: yqiT fwd: agcccgtgtagtactgtagagtt using PCR program 1 and Ex-taq. This PCR reaction attaches a Biobrick prefix and suffix to the gene.
Sequencing
TransformationLigationInfusionGel PurificationRE Digest |