Team:KU Seoul/Details

From 2009.igem.org

(Difference between revisions)
(→Experiment Dairy)
(→Experiment Dairy)
Line 144: Line 144:
*090922
*090922
#Part linkage PCR
#Part linkage PCR
-
#Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃
+
::Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃
 +
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"
 +
! PCR mixture
 +
! volume (μl)
 +
|-
 +
|Template [PCR products of each part diluted 10-fold]] ||align="center"| 1
 +
|-
 +
|2.5mM dNTP ||align="center"| 4
 +
|-
 +
|forward-primer (10pmol/μl) ||align="center"| 2
 +
|-
 +
|reverse-primer (10pmol/μl) || align="center"| 2
 +
|-
 +
|10x Synergy™ buffer || align="center"| 5
 +
|-
 +
|Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) || align="center"| 0.05
 +
|-
 +
|D.W. || align="center"| 35.5
 +
|}
 +
:2. Result (Figure 3)
 +
[[Image:KU_Seoul_3.jpg]]
 +
*090923
 +
:1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly
 +
::1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul
 +
::2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul
 +
::3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min
 +
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"
 +
! Reaction mixture
 +
! volume (μl)
 +
|-
 +
|Purified PCR product ||align="center"| 43
 +
|-
 +
|BSA (NEB) (10mg/ml) ||align="center"| 1
 +
|-
 +
|10x NEB buffer 2 ||align="center"| 5
 +
|-
 +
|T4 DNA polymerase (0.6U/μl) || align="center"| 1
 +
|}
 +
::4) Clean-up – eleution : 40ul
 +
::5) 0.8% agarose gel electrophoresis
 +
 
 +
*090923~090924
 +
#Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5
 +
##Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min
 +
##Transformation to E. coli DH5a
 +
##Results >> vector only : 2, vector + INS : 4
 +
*090925-27, 090929~091001
 +
:1. Cloning results
 +
{| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1"
 +
! Plate
 +
! Number of colonies
 +
! Plasmid prep.
 +
|-
 +
|pSB3C5 vector || align="center"|2 ||align="center"| 1
 +
|-
 +
|pSB3C5 + Pars-gfp-Pznt-rfp || align="center"|5 ||align="center"| 1/3
 +
|-
 +
|pSB3T5 vector || align="center"|3 ||align="center"| 1
 +
|-
 +
|pSB3T5 + PyodA-AMD || align="center"|14 ||align="center"| 5/6
 +
|}
 +
:2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)
 +
[[Image:KU_Seoul_4.jpg]]
 +
*091005~091006
 +
#Sequencing by Macrogen
 +
#Transformation to E. coli DH5a
 +
*091010~091020
 +
#Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence
 +
##E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation  at 37℃ for 12h
 +
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃
 +
##Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth
 +
##Incubation for 60min at 37℃
 +
##Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)
 +
#Procedure for detecting Cd2+ & Construction of calibration curve
 +
##E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation  at 37℃ for 12h
 +
##Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃
 +
##Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃
 +
##Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min
 +
##Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃
 +
##Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature
 +
##The amount of p-aminophenol was determined by a spectrophotometer (615 nm)
 +
 
 +
 
|}
|}

Revision as of 07:54, 20 October 2009






The Experiments

Materials

  • Backbone Plasmids
    • Plasmid pSB3C5 with [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] : 2009 Kit Plate 1 [5C]
    • Plasmid pSB3T5 with [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] : 2009 Kit Plate 1 [9C]
  • Promoters
    • Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue
  • Protein Coding Sequences
    • [http://partsregistry.org/Part:BBa_E0044 Green fluorescent protein(BBa_E0044)]  : 2009 Kit Plate 1 [14G]
    • [http://partsregistry.org/Part:BBa_E1010 Red fluorescent protein(BBa_E1010)] : 2009 Kit Plate 1 [18F]
    • Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]
  • Primers
Template Primer Sequence Length(bp)
Plasmid pSB3C5 pSB3C5_F gctgctgttTAATAAtactagtagcggccgctgc 34
pSB3C5(+Pars)_R taataggtgtgaattttgagttggCtctagaagcggccgcga 42
Plasmid pSB3T5 pSB3T5_F gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc 49
pSB3T5_R GTCGGCAATATGAAGctctagaagcggccgcga 33
Promoter yodA PyodA_F cggccgcttctagagCTTCATATTGCCGACAAAGTACG 38
PyodA_R ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG 38
Green fluorescent protein GR(+Pars)_F aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc 78
gtaaaggagaagaacttttcactg
GR(+Pznt)_R ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg 84
TCTAGTttattaaacagcagcagcgtagttttcg
Red fluorescent protein RF(+Pznt)_F tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG 75
gcttcctccgaagacgttatca
RF(+AAV tag)_R TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg 59
agtgacgac
Aryl acylamidase AMD_F CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG 37
AMD(+AAV tag)_R TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC 55
CGTCCGGCG
  • Chemicals
    • Acetaminophen (Sigma)
    • CdCl2∙H2O (Junsei)
    • ZnCl2 (Sigma)
    • KH2AsO3 (Sigma)
    • Luria-Bertani broth & Bacto agar (Difco)
    • o-Cresol (Sigma)
    • CuSO4∙5H2O (Sigma)

Experiment Dairy

  • 090914
  1. Streaking of E. coli XL-1 Blue
  2. Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours
  3. Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell
  4. Design of cloning primers & ordering the primers
  • 090915
  1. Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction
  2. Preparation of E. coli DH5a competent cell (based on BSGC protocol)
  • 090917
  1. Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)
  2. Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit
  • 090918
  1. Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth


  • 090919
  1. Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit
  2. 0.8% agarose gel electrophoresis (Figure 1)

KU Seoul 1.jpeg

  • 090921
  1. PCR of BioBrick Parts
General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃
PCR mixture volume (μl)
Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) 1
2.5mM dNTP 4
forward-primer (10pmol/μl) 2
reverse-primer (10pmol/μl) 2
10x Synergy™ buffer 5
Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) 0.5
D.W. 35.5
Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃
PCR mixture volume (μl)
Template [mini prep. samples of plasmid : pSB3C5 and pSB3T5] 1
2.5mM dNTP 4
forward-primer (10pmol/μl) 2
reverse-primer (10pmol/μl) 2
10x Synergy™ buffer 5
5x Q-solution 10
Hot start taq™ (Qiagen) (5U/μl) 0.05
D.W. 25.5
2. Result (Figure 2)

KU Seoul 2.jpg

  • 090922
  1. Part linkage PCR
Linkage PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃
PCR mixture volume (μl)
Template [PCR products of each part diluted 10-fold]] 1
2.5mM dNTP 4
forward-primer (10pmol/μl) 2
reverse-primer (10pmol/μl) 2
10x Synergy™ buffer 5
Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) 0.05
D.W. 35.5
2. Result (Figure 3)

KU Seoul 3.jpg

  • 090923
1.Cloning of gfp-rfp to pSB3C5 by Infusion Assembly
1) Clean-up of each PCR products by LaboPass™ Gel and PCR Clean-up Kit – elution : 43ul
2) DpnI (10U/μl) reaction of pSB3C5 and pSB3T5 PCR product at 37℃ for 3-h and clean-up – elution : 43ul
3) T4 DNA polymerase reaction of purified PCR products : Incubation at room temperature for 30min
Reaction mixture volume (μl)
Purified PCR product 43
BSA (NEB) (10mg/ml) 1
10x NEB buffer 2 5
T4 DNA polymerase (0.6U/μl) 1
4) Clean-up – eleution : 40ul
5) 0.8% agarose gel electrophoresis
  • 090923~090924
  1. Cloning of Pars-gfp-Pznt-rfp to pSB3C5 & PyodA-AMD to pSB3T5
    1. Annealing & Transformation : 2ul insert + 2ul pSB3 vector at room temperature for 30min
    2. Transformation to E. coli DH5a
    3. Results >> vector only : 2, vector + INS : 4
  • 090925-27, 090929~091001
1. Cloning results
Plate Number of colonies Plasmid prep.
pSB3C5 vector 2 1
pSB3C5 + Pars-gfp-Pznt-rfp 5 1/3
pSB3T5 vector 3 1
pSB3T5 + PyodA-AMD 14 5/6
2. Plasmid mini prep. & 0.8% agarose gel electrophoresis (Figure 4)

KU Seoul 4.jpg

  • 091005~091006
  1. Sequencing by Macrogen
  2. Transformation to E. coli DH5a
  • 091010~091020
  1. Procedure for detecting Zn2+ and AsO3- & Construction of calibration curve for red fluorescence
    1. E. coli DH5a harboring pSB3C5/Pars-gfp-Pznt-rfp >> inoculation to 5ml LBC broth and incubation at 37℃ for 12h
    2. Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃
    3. Addition of various concentration of Zn2+ (0, 0.25, 0.5, 1, 1.5, 2mM) & AsO3- (0, 0.0625, 0.125, 0.25, 0.5, 0.75, 1mM) to 1ml incubated broth
    4. Incubation for 60min at 37℃
    5. Detection by Multilabel Plate Reader (FL/LU) (Perkin Elmer) and Microplate Spectrophotometer (Bio-Tek)
  2. Procedure for detecting Cd2+ & Construction of calibration curve
    1. E. coli DH5a harboring pSB3T5/PyodA-AMD >> inoculation to 5ml LBT broth and incubation at 37℃ for 12h
    2. Inoculation 50ml LBC and incubation to OD600 ~0.5 at 37℃
    3. Addition of various concentration of Cd2+ (0, 0.05, 0.1, 0.2, 0.4 and 0.8mM) to 1ml incubated broth and storage at 4℃
    4. Incubation for 60min at 37℃ and centrifugation at 8,000rpm for 1min
    5. Resuspension to 1ml reaction mixture ( 100mM AAP in 0.1M Tris buffer pH 9.0) and incubation for 10min at 37℃
    6. Stopped with the addition of 2 mL of 1 % (vol/vol) o-cresol and 0.2 mL of 0.2 % (wt/vol) CuSO4 in 1.6 % (vol/vol) NH4OH. After 10 min of incubation at room temperature
    7. The amount of p-aminophenol was determined by a spectrophotometer (615 nm)


Retrieved from "http://2009.igem.org/Team:KU_Seoul/Details"