Team:EPF-Lausanne/Notebook

From 2009.igem.org

(Difference between revisions)
Line 14: Line 14:
<br>Some comments on the plasmid:  
<br>Some comments on the plasmid:  
<br>-CBP is a small peptide with which we could purify LOVTAP protein
<br>-CBP is a small peptide with which we could purify LOVTAP protein
-
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once lOVTAP is purified
+
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
;Cloning strategy:
;Cloning strategy:
-
Four forward primers were designed to amplify:
+
<br>Four forward primers were designed to amplify:
-
#Promoter T7, RBS, CBP and LOVTAP  
+
#Promoter T7, RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
-
#RBS, CBP and LOVTAP  
+
#RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
-
#CBP and LOVTAP
+
#CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
-
#LOVTAP
+
#LOVTAP: gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
 +
<br>One reverse primer were designed: gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
 +
 
{| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
{| style="color:#1b2c8a;background-color:#0c9;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"

Revision as of 16:05, 6 July 2009



Contents

Notebook

06.07.09

Wet lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli, and grown overnight.
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid


Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified

Cloning strategy


Four forward primers were designed to amplify:

  1. Promoter T7, RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
  2. RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
  3. CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
  4. LOVTAP: gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac


One reverse primer were designed: gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc


Home The Team The Project Parts Submitted to the Registry Modeling Notebook Lectures Team Management References
Retrieved from "http://2009.igem.org/Team:EPF-Lausanne/Notebook"