Notebook

06.07.09

Wet lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid

Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified

Cloning strategy

Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg

2.RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag

3.CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag

4.LOVTAP:

gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac

One reverse primer were designed:

gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc

The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 5G in the received kit plate 1

People in the lab

Tu, Heidi, Rafael, Basile, Nath

07.07.09

Remark for the notebook

First, it's great you already started to use the wiki and customised the menu!
Then I think we should add the name of the peoples who worked on each part of a process (or at least present the same day). It would allow easy team transitions.
For the wiki in general, as you did in this page, it is much better not to use html tags.
We will have a meeting for the modeling on tuesday, I will come to the lab before.

Wet lab

We have to grow the 3 strains generously sent by Tom Beatty

The three strains are :

• R.Palustris CEA001 (wild type) ; should be grown on LB medium only
• R.Palustris BPHP1+ ; should be grown on LB with gentamycin (100 micrograms/ml)
• E.Coli DH10B (pBPH/hmu0) ; should be grown on LB with gentamycin (20 micorgrams/ml)

The transformed LOVTAP and TrpR worked well (N.B. the plasmid of TrpR is pUC19 so the antibiotic resistance is Amp -> see below)

pUC19 plasmid

We did the glycerol stock, located in the -80 fridge, first floor of the iGEM compartement.

Then, a miniprep was done with both cultures. A LOVTAP plasmid aliquot was done, a TrpR plasmid aliquot was done, located in the -20 fridge, 2nd floor.

People in the lab

Tu, Rafael, Nath, Heidi, Basile

Cloning strategy

To design plasmids : software Vector NTI