Team:KULeuven/13 July 2009

From 2009.igem.org

(Difference between revisions)
(Odor synthesis/sensor)
(Light sensor)
Line 18: Line 18:
*YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
*YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
*Probable strain K12
*Probable strain K12
-
*Promotor:
+
*Promotor voor YCGF gene:
 +
**AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTGTGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAGTTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTTTTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATTCTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGC'''ATG''' (bron: [www.ncbi.nlm.nih.gov])
==Odorless strain of E.coli==
==Odorless strain of E.coli==

Revision as of 14:28, 13 July 2009

Contents

Project progress

A & B (comparator), ideas

Key/lock system, see [http://parts2.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Riboregulators (Berkeley 2006)]

Odor synthesis/sensor

  • Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
    • Combination of 5 genes; 3 ervan zijn beschikbaar
      • [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthese stappen door Edinburgh igem 2007)
    • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp

Light sensor

  • YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
  • Probable strain K12
  • Promotor voor YCGF gene:
    • AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTGTGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAGTTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTTTTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATTCTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])

Odorless strain of E.coli

  • [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline defficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
  • Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'

To do

Drylab

[http://www.kuleuven.be/rega/mvr/bookmarktsdl.html BioInformatics bookmarks]

Wiki

  • create Ideas page
  • Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki

Wetlab

Experiment Name

Description

Elaboration

Results and conclusions

Remarks