Team:EPF-Lausanne/Notebook/Cloning Strategy
From 2009.igem.org
(→08.07.09) |
(→08.07.09) |
||
Line 28: | Line 28: | ||
===08.07.09=== | ===08.07.09=== | ||
Inducible LOVTAP biobrick strategy | Inducible LOVTAP biobrick strategy | ||
- | : Problem to overcome: Pst sites in LOVTAP sequence. | + | :*Problem to overcome: |
- | :*Our goal: Biobrick LacI promoter-RBS-LOVTAP-Term ( in this order). | + | Pst sites in LOVTAP sequence. |
- | :*Material: Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate). | + | :*Our goal: |
- | :*Strategy: LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP). | + | Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order). |
+ | :*Material: | ||
+ | Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate). | ||
+ | :*Strategy: | ||
+ | LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP). | ||
LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously). | LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously). | ||
Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX. | Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX. |
Revision as of 15:49, 14 July 2009
Contents |
Cloning strategy
July
06.07.09
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
07.07.09
To design plasmids : software Vector NTI
08.07.09
Inducible LOVTAP biobrick strategy
- Problem to overcome:
Pst sites in LOVTAP sequence.
- Our goal:
Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order).
- Material:
Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate).
- Strategy:
LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP). LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously). Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX.
09.07.09
Partial digestion strategy.
10.07.09
13.07.09
Restriction enzymes on [http://www.neb.com/nebecomm/products/category1.asp?#2 Biolabs website] and [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp clevage oligonucleotides]
TRP promoter biobrick strategy
14.07.09
Primers designed for LOVTAP read-out and RBphP project:
1.Forward primer Trp promoter:
- gtttcttc gaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgc
2.Reverse primer Trp promoter:
- ctagctagctaggtcgataccctttttacgtgaacttgcgtactagttaactagttcgatgattaattgtca
3.1st Forward primer Inverter TetR:
- aatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc
4.2nd Forward primer Inverter TetR:
- gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta
5.Reverse Primer Inverter TetR:
- ctagctagctag tttctcctctttctctagtagtgc
6.Forward primer ppsR1 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatgctggaggatatttgccctggtg
7.Reverse primer ppsR1 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtattactcatcggctccgtctccttc
8.Forward primer ppsR2 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatggcgtcaaagtccgttcatgcc
9.Reverse primer ppsR2 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtatcaatcctctgcgtcgtctgagg
10.Forward primer BrBphP Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgcccgttccgctgacgac
11.Reverse primer BrBphP Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtatcactcctcgctctgcgagc
12.Forward primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgagggcgttcagagctcc
13.Reverse primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactattccaactgactgtcttcttcgc
14.Forward primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatggccgagtttcacggtccac
15.Reverse primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactagctccccttttcggtttcctc