Team:Cambridge/Notebook/Week3
From 2009.igem.org
(→Monday) |
(→Monday) |
||
Line 12: | Line 12: | ||
[[Image:MelA_primers.JPG]] | [[Image:MelA_primers.JPG]] | ||
+ | |||
+ | These correspond to the parts on the gene shown below. The stars correspond to the two unwanted restriction sites. | ||
+ | |||
+ | [[Image:MelA_primer_map.JPG]] | ||
'''Orange Pigment''' | '''Orange Pigment''' |
Revision as of 11:15, 27 July 2009
Categories :
Project :
-
Overview
Sensitivity Tuner
--- Characterisation
--- Modelling
Colour Generators
--- Carotenoids (Orange/Red)
--- Melanin (Brown)
--- Violacein (Purple/Green)
The Future
Safety
Notebook :
Team Logistics :
Week 3 - Development
Monday
Primer Design
Primers were designed to convert MelA into a biobrick. Primers A and F are for either end (including prefix and suffix - highlighted in green). The other primers surround the unwanted restiction sites (highlighted in yellow) with the changed base in red.
These correspond to the parts on the gene shown below. The stars correspond to the two unwanted restriction sites.
Orange Pigment
Used plasmid editor to examine the genes used for the production of orange pigments. The (supposedly) orange-producing pigment from the biobricks:
We also tried a preliminary design for a biobrick we could construct, in case the orange biobrick does not function. This uses the same genetic synthetic pathway for gene consruction:
Transformed Pigments
The MelA plate left on the bench overnight produced a brown-coloured pigment! Growth on media containing IPTG should produce this pigment a lot faster.
Amplification system
Activators
Found parts submitted by Cambridge '07 team amplifier project. Three translational units (ribosome binding sites and protein coding sequence) for the three activators. Sequence below.
Ogr activator from P2 phage: Part I746350
>BBa_I746350 Part-only sequence (237 bp)
aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatc
atcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgca
cccgttgccatcagggcagcaaattatgtggatgtaa
pag activator from PSP3 phage: Part I746351
>BBa_I746351 Part-only sequence (237 bp) aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatc accagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgcccca ccccatcagaaaccaacaacagcaactttggctttga
delta activator from phiR73 phage: Part I746352
>BBa_I746352 Part-only sequence (264 bp) aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatc tccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggc aagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa
(delete sequence if you think its unnecessary and just leave part names)