"
Team:Warsaw/Glossary
From 2009.igem.org
(Difference between revisions)
| Line 2: | Line 2: | ||
__NOTOC__ | __NOTOC__ | ||
| - | + | =Glossary= | |
==A== | ==A== | ||
| Line 8: | Line 8: | ||
====apoptosis==== | ====apoptosis==== | ||
| - | <div class="glossary_text">Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and its function is to remove damaged and unnecessary cells from the organism. In our project we want to induce apoptosis of tumor cells, using | + | <div class="glossary_text">Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and its function is to remove damaged and unnecessary cells from the organism. In our project we want to induce apoptosis of tumor cells, using |
| - | + | </div> | |
==B== | ==B== | ||
| Line 15: | Line 15: | ||
====bax==== | ====bax==== | ||
| - | + | ||
<div class="glossary_text">Bcl-2–associated X protein (bax) is a pro-apoptotic protein. Although it's found mainly in the cytosol, upon initiation of [https://2009.igem.org/Team:Warsaw/Glossary#apoptosis apoptosis] it's shifted to organellar membranes. It's believed that bax is responsible for opening special channels in the mitochondrial outer membrane, causing release of pro-apoptotic factors like cytochrome c. These proteins subsequently assembly a multiprotein complex named apoptosome which activated special proteases called caspases which destine the cell to apoptosis.</div> | <div class="glossary_text">Bcl-2–associated X protein (bax) is a pro-apoptotic protein. Although it's found mainly in the cytosol, upon initiation of [https://2009.igem.org/Team:Warsaw/Glossary#apoptosis apoptosis] it's shifted to organellar membranes. It's believed that bax is responsible for opening special channels in the mitochondrial outer membrane, causing release of pro-apoptotic factors like cytochrome c. These proteins subsequently assembly a multiprotein complex named apoptosome which activated special proteases called caspases which destine the cell to apoptosis.</div> | ||
| Line 35: | Line 35: | ||
<div class="glossary text">Cro repressor is a small dimeric protein which binds to specific sites on the DNA of bacteriophage lambda. Fragment of the phage DNA that is recognized by cro is known as cro-box. Recognition of specific DNA binding sites appears to occur via multiple hydrogen bonds between amino acid side chains of the protein and base pair atoms exposed within the major groove of DNA. Cro act as a transcription inhibitor which binds OR3, OR2 and OR1 sites. At low concentrations blocks the pRM promoter preventing cI production. At high concentrations downregulates its own production through OR2 and OR1 binding.</div> | <div class="glossary text">Cro repressor is a small dimeric protein which binds to specific sites on the DNA of bacteriophage lambda. Fragment of the phage DNA that is recognized by cro is known as cro-box. Recognition of specific DNA binding sites appears to occur via multiple hydrogen bonds between amino acid side chains of the protein and base pair atoms exposed within the major groove of DNA. Cro act as a transcription inhibitor which binds OR3, OR2 and OR1 sites. At low concentrations blocks the pRM promoter preventing cI production. At high concentrations downregulates its own production through OR2 and OR1 binding.</div> | ||
| - | + | ||
====cro-box==== | ====cro-box==== | ||
| Line 45: | Line 45: | ||
<div class="glossary text">The enzyme cytochrome c oxidase or Complex IV is a large transmembrane protein complex found in bacteria and the mitochondrion. It is the last enzyme in the respiratory electron transport chain located in the mitochondrial (or bacterial) membrane. It receives an electron from each of four cytochrome c molecules, and transfers them to one oxygen molecule, converting molecular oxygen to two molecules of water. In the process, it binds and translocates four protons across the membrane, helping to establish a transmembrane proton concentration gradient which is crucial for the ATP synthase to synthesize ATP.</div> | <div class="glossary text">The enzyme cytochrome c oxidase or Complex IV is a large transmembrane protein complex found in bacteria and the mitochondrion. It is the last enzyme in the respiratory electron transport chain located in the mitochondrial (or bacterial) membrane. It receives an electron from each of four cytochrome c molecules, and transfers them to one oxygen molecule, converting molecular oxygen to two molecules of water. In the process, it binds and translocates four protons across the membrane, helping to establish a transmembrane proton concentration gradient which is crucial for the ATP synthase to synthesize ATP.</div> | ||
| - | + | ||
==D== | ==D== | ||
| Line 57: | Line 57: | ||
====endosome==== | ====endosome==== | ||
| - | |||
<div class="glossary text">endosome is a membrane-bound compartment inside cells which is responsible for the sorting of ematerial previously endocytosed by the cell, before transport to lysosomes. This allows some material to be returned to the plasma membrane.</div> | <div class="glossary text">endosome is a membrane-bound compartment inside cells which is responsible for the sorting of ematerial previously endocytosed by the cell, before transport to lysosomes. This allows some material to be returned to the plasma membrane.</div> | ||
| Line 65: | Line 64: | ||
<div class="glossary text">The green fluorescent protein (GFP) is protein which exhibits intensive green fluorescence when exposed to blue light. Although many other marine organisms have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish ''Aequorea victoria''. The GFP from ''A. victoria'' has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum. In the field of cell and molecular biology, the GFP gene is frequently used as a reporter of expression. Many different mutants of GFP have been engineered since their potential for widespread usage. The collection of the mutagenized forms include many color mutants.</div> | <div class="glossary text">The green fluorescent protein (GFP) is protein which exhibits intensive green fluorescence when exposed to blue light. Although many other marine organisms have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish ''Aequorea victoria''. The GFP from ''A. victoria'' has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum. In the field of cell and molecular biology, the GFP gene is frequently used as a reporter of expression. Many different mutants of GFP have been engineered since their potential for widespread usage. The collection of the mutagenized forms include many color mutants.</div> | ||
| - | |||
==I== | ==I== | ||
| Line 71: | Line 69: | ||
====integrins==== | ====integrins==== | ||
| - | <div class="glossary text">Integrins are cellular receptors that mediate attachment between a cell and the tissues surrounding it, which may be other cells or the extracellular matrix (ECM). They are also involved in cell signaling and thereby define cellular shape, mobility, and regulate the cell cycle. Many types of integrin exist, and some cells have multiple types of integrins on their surface. Integrins are of vital importance to all animals and have been found in each investigated animal plylum. Several integrin types are recognized by invasins, bacterial surface proteins which are responsible for entrance of bacterium into the cell.</div> | + | <div class="glossary text">Integrins are cellular receptors that mediate attachment between a cell and the tissues surrounding it, which may be other cells or the extracellular matrix (ECM). They are also involved in cell signaling and thereby define cellular shape, mobility, and regulate the cell cycle. Many types of integrin exist, and some cells have multiple types of integrins on their surface. Integrins are of vital importance to all animals and have been found in each investigated animal plylum. Several integrin types are recognized by invasins, bacterial surface proteins which are responsible for entrance of bacterium into the cell.</div> |
====internalin==== | ====internalin==== | ||
<div class="glossary text">Internalins are surface proteins found on ''Listeria monocytogenes''. There are two diiferent forms of these proteins, InlA and InlB. Both of them are used by the bacteria to invade mammalian cells via cadherins transmembrane proteins which exist on the cellular membrane. The exact role of these proteins and their invasiveness in vivo is in not yet completely understood. In cultured cells, InlA is necessary to facilitate ''Listeria'' entry into human epithelial cells. However InlB is necessary for bacterial cell internalisation in several other cell types, including hepatocytes and fibroblasts.</div> | <div class="glossary text">Internalins are surface proteins found on ''Listeria monocytogenes''. There are two diiferent forms of these proteins, InlA and InlB. Both of them are used by the bacteria to invade mammalian cells via cadherins transmembrane proteins which exist on the cellular membrane. The exact role of these proteins and their invasiveness in vivo is in not yet completely understood. In cultured cells, InlA is necessary to facilitate ''Listeria'' entry into human epithelial cells. However InlB is necessary for bacterial cell internalisation in several other cell types, including hepatocytes and fibroblasts.</div> | ||
| - | |||
| - | |||
====invasin==== | ====invasin==== | ||
| - | <div class="glossary_text"> | + | <div class="glossary_text">Invasin is one of proteins crucial for pathogenic features of enteropathogenic bacteria like ''Yersinia'' sp. or ''Salmonella'' sp. Invasin interacts with integrins, receptors occuring on the surface of eukariotic cell membrane, what triggers signalling cascade leading to endocytosis of whole pathogenic bacteria. |
| - | + | <div> | |
==L== | ==L== | ||
| Line 88: | Line 84: | ||
====lacI==== | ====lacI==== | ||
| - | <div class="glossary text"> | + | <div class="glossary text">The lac repressor is a bacterial DNA-binding protein which inhibits the expression of genes which encode proteins involved in the metabolism of lactose. It is active in the absence of lactose, ensuring that the bacterium only invests its resources for the synthesis of proteins required for the uptake and metabolism of lactose when this saccharide is found in the environment. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.</div> |
====listeriolysin==== | ====listeriolysin==== | ||
| - | <div class="glossary text"> | + | <div class="glossary text">Listeriolysin O (LLO) is a pore-forming protein from ''Listeria monocytogenes'' which belong to hemolysin family.The protein is selectively activated within the acidic phagosomes (average pH ~ 5.9) of cells that have phagocytosed ''L. monocytogenes''. After LLO lyses the phagosome, the bacterium escapes into the cytosol, where it can grow intracellularly. Upon release from the phagosome, the toxin has reduced activity in the more basic cytosol.</div> |
==M== | ==M== | ||
| Line 102: | Line 98: | ||
====mitochondrial diseases==== | ====mitochondrial diseases==== | ||
| - | <div class="glossary text"> | + | <div class="glossary text">Mitochondrial diseases are a group of disorders relating to the interrupted function of the mitochondrion. They are comprise those disorders that affect the function of the proteins in the mitochondria or are due to mitochondrial DNA damage. Mitochondrial diseases take on unique characteristics both because of the way the diseases are often inherited and because mitochondria are pivotal to cell survivability. The subclass of these diseases that have neuromuscular disease symptoms are often referred to as a mitochondrial myopathy.</div> |
==P== | ==P== | ||
| Line 108: | Line 104: | ||
====p53==== | ====p53==== | ||
| - | <div class="glossary_text"> | + | <div class="glossary_text">p53 is a protein well-known for people interested in cancer. p53 is a tumor suppressor and main factor involved in control of cell-cycle, mutated in more than half of tumors. Some data shows that presence of p53 in mitochondria is able to induce [https://2009.igem.org/Team:Warsaw/Glossary#apoptosis apoptosis]. |
</div> | </div> | ||
| Line 121: | Line 117: | ||
<div class="glossary text"> Type I secretion system (TOSS) is a simple system, which consists of only three protein subunits: the ABC protein, membrane fusion protein (MFP), and outer membrane protein (OMP). Type I secretion system transports molecules of various size, from ions, drugs to even large proteins. The best characterized proteins secret via TOSS are the RTX toxins and the lipases. Type I secretion is also involved in export of non-proteinaceous substrates like cyclic β-glucans and polysaccharides. Many secreted proteins are particularly important in bacterial pathogenesis.</div> | <div class="glossary text"> Type I secretion system (TOSS) is a simple system, which consists of only three protein subunits: the ABC protein, membrane fusion protein (MFP), and outer membrane protein (OMP). Type I secretion system transports molecules of various size, from ions, drugs to even large proteins. The best characterized proteins secret via TOSS are the RTX toxins and the lipases. Type I secretion is also involved in export of non-proteinaceous substrates like cyclic β-glucans and polysaccharides. Many secreted proteins are particularly important in bacterial pathogenesis.</div> | ||
| - | + | ||
====TetR==== | ====TetR==== | ||
<div class="glossary text">TetR is an abbreviation of a family of bacterial transcriptional regulators which control the expression of genes responsible for resistance against tetracycline. Tetracyclines are amid of the most commonly used antibiotics and many gram-negative bacteria have developed mechanism of resistance against these antibiotics. The most abundant mechanism involved a membrane-associated proteins which exports tetracycline out of the bacterial membrane before it may act within the cell.</div> | <div class="glossary text">TetR is an abbreviation of a family of bacterial transcriptional regulators which control the expression of genes responsible for resistance against tetracycline. Tetracyclines are amid of the most commonly used antibiotics and many gram-negative bacteria have developed mechanism of resistance against these antibiotics. The most abundant mechanism involved a membrane-associated proteins which exports tetracycline out of the bacterial membrane before it may act within the cell.</div> | ||
| - | + | ||
{{WarFoot1}} | {{WarFoot1}} | ||
Revision as of 13:02, 15 October 2009
Glossary
A
apoptosis
Apoptosis is a natural process of programmed cell death. Apoptosis can be induced by many factors and its function is to remove damaged and unnecessary cells from the organism. In our project we want to induce apoptosis of tumor cells, using
B
bax
Bcl-2–associated X protein (bax) is a pro-apoptotic protein. Although it's found mainly in the cytosol, upon initiation of apoptosis it's shifted to organellar membranes. It's believed that bax is responsible for opening special channels in the mitochondrial outer membrane, causing release of pro-apoptotic factors like cytochrome c. These proteins subsequently assembly a multiprotein complex named apoptosome which activated special proteases called caspases which destine the cell to apoptosis.
C
cI
This protein is also known as the lambda repressor. cI is sole protein expressed in the lysogenic state of Lambda phage. It act as transcription inhibitor which binds to specific sites in phage genome. At low concentrations blocks the pR promoter (preventing cro production). At high concentrations downregulates its own production through OR3 binding
.
comparative modeling
These methods use previously solved structures as templates. This methodology is effective because of appearance only a limited set of tertiary structural motifs to which most proteins belong. These methods may be split into two groups:
Homology modeling is based on the assumption that two homologous proteins will share very similar structures. Because a protein's fold is more evolutionarily conserved than its amino acid sequence, a target sequence can be modeled with reasonable accuracy on a very distantly related template, provided that the relationship between target and template can be discerned through sequence alignment.
Protein threading analyse the amino acid sequence of an unknown structure against a database of solved structures. In each case, a scoring function is used to assess the compatibility of the sequence to the structure, thus yielding possible three-dimensional models.
cro
Cro repressor is a small dimeric protein which binds to specific sites on the DNA of bacteriophage lambda. Fragment of the phage DNA that is recognized by cro is known as cro-box. Recognition of specific DNA binding sites appears to occur via multiple hydrogen bonds between amino acid side chains of the protein and base pair atoms exposed within the major groove of DNA. Cro act as a transcription inhibitor which binds OR3, OR2 and OR1 sites. At low concentrations blocks the pRM promoter preventing cI production. At high concentrations downregulates its own production through OR2 and OR1 binding.
cro-box
Cro-box is the particular fragment of phage lambda DNA which is recognized by aforementioned cro repressor. In our project we used artificial designed cro-box sequence:
5' ATCTAGATACCTCTGGCGGTGATACTAGTGT 3'
cytochrome C oxidase
The enzyme cytochrome c oxidase or Complex IV is a large transmembrane protein complex found in bacteria and the mitochondrion. It is the last enzyme in the respiratory electron transport chain located in the mitochondrial (or bacterial) membrane. It receives an electron from each of four cytochrome c molecules, and transfers them to one oxygen molecule, converting molecular oxygen to two molecules of water. In the process, it binds and translocates four protons across the membrane, helping to establish a transmembrane proton concentration gradient which is crucial for the ATP synthase to synthesize ATP.
D
de novo modeling
De novo protein modelling methods attempt to build three-dimensional protein models based on physical principles. There are few possible procedures that are able to reconstruct folding pathway or apply some stochastic method to search native conformations. These procedures tend to require vast computational resources, and have thus only been carried out for small proteins.
E
endosome
endosome is a membrane-bound compartment inside cells which is responsible for the sorting of ematerial previously endocytosed by the cell, before transport to lysosomes. This allows some material to be returned to the plasma membrane.
G
Green Fluorescent Protein
The green fluorescent protein (GFP) is protein which exhibits intensive green fluorescence when exposed to blue light. Although many other marine organisms have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish Aequorea victoria. The GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum. In the field of cell and molecular biology, the GFP gene is frequently used as a reporter of expression. Many different mutants of GFP have been engineered since their potential for widespread usage. The collection of the mutagenized forms include many color mutants.
I
integrins
Integrins are cellular receptors that mediate attachment between a cell and the tissues surrounding it, which may be other cells or the extracellular matrix (ECM). They are also involved in cell signaling and thereby define cellular shape, mobility, and regulate the cell cycle. Many types of integrin exist, and some cells have multiple types of integrins on their surface. Integrins are of vital importance to all animals and have been found in each investigated animal plylum. Several integrin types are recognized by invasins, bacterial surface proteins which are responsible for entrance of bacterium into the cell.
internalin
Internalins are surface proteins found on Listeria monocytogenes. There are two diiferent forms of these proteins, InlA and InlB. Both of them are used by the bacteria to invade mammalian cells via cadherins transmembrane proteins which exist on the cellular membrane. The exact role of these proteins and their invasiveness in vivo is in not yet completely understood. In cultured cells, InlA is necessary to facilitate Listeria entry into human epithelial cells. However InlB is necessary for bacterial cell internalisation in several other cell types, including hepatocytes and fibroblasts.
invasin
Invasin is one of proteins crucial for pathogenic features of enteropathogenic bacteria like Yersinia sp. or Salmonella sp. Invasin interacts with integrins, receptors occuring on the surface of eukariotic cell membrane, what triggers signalling cascade leading to endocytosis of whole pathogenic bacteria.
L
lacI
The lac repressor is a bacterial DNA-binding protein which inhibits the expression of genes which encode proteins involved in the metabolism of lactose. It is active in the absence of lactose, ensuring that the bacterium only invests its resources for the synthesis of proteins required for the uptake and metabolism of lactose when this saccharide is found in the environment. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.
listeriolysin
Listeriolysin O (LLO) is a pore-forming protein from Listeria monocytogenes which belong to hemolysin family.The protein is selectively activated within the acidic phagosomes (average pH ~ 5.9) of cells that have phagocytosed L. monocytogenes. After LLO lyses the phagosome, the bacterium escapes into the cytosol, where it can grow intracellularly. Upon release from the phagosome, the toxin has reduced activity in the more basic cytosol.
M
mgtc gene promoter
This is one of the Salmonella typhimurium PhoP-dependent promoters. MgtC gene is a virulence factor in Salmonella typhimurium that is required for growth at low-Mg2+ concentrations and intramacrophage survival
mitochondrial diseases
Mitochondrial diseases are a group of disorders relating to the interrupted function of the mitochondrion. They are comprise those disorders that affect the function of the proteins in the mitochondria or are due to mitochondrial DNA damage. Mitochondrial diseases take on unique characteristics both because of the way the diseases are often inherited and because mitochondria are pivotal to cell survivability. The subclass of these diseases that have neuromuscular disease symptoms are often referred to as a mitochondrial myopathy.
P
p53
p53 is a protein well-known for people interested in cancer. p53 is a tumor suppressor and main factor involved in control of cell-cycle, mutated in more than half of tumors. Some data shows that presence of p53 in mitochondria is able to induce apoptosis.
phoP/PhoQ
PhoP/PhoQ is a two-component regulatory system which controls the virulence of Salmonella typhimurium. Under conditions of low pH and/or low metal ions concentration PhoP activates promoters responsible for virulence and survival of Salmonella within macrophages, like the promoter of mgtc gene. Whole system will be used to control bacteria escape from endosome
T
Type I secretion system
Type I secretion system (TOSS) is a simple system, which consists of only three protein subunits: the ABC protein, membrane fusion protein (MFP), and outer membrane protein (OMP). Type I secretion system transports molecules of various size, from ions, drugs to even large proteins. The best characterized proteins secret via TOSS are the RTX toxins and the lipases. Type I secretion is also involved in export of non-proteinaceous substrates like cyclic β-glucans and polysaccharides. Many secreted proteins are particularly important in bacterial pathogenesis.
TetR
TetR is an abbreviation of a family of bacterial transcriptional regulators which control the expression of genes responsible for resistance against tetracycline. Tetracyclines are amid of the most commonly used antibiotics and many gram-negative bacteria have developed mechanism of resistance against these antibiotics. The most abundant mechanism involved a membrane-associated proteins which exports tetracycline out of the bacterial membrane before it may act within the cell.
