Team:KU Seoul/Details
From 2009.igem.org
(Difference between revisions)
Line 15: | Line 15: | ||
{|style= "background:#FFCC33;" align="center" | {|style= "background:#FFCC33;" align="center" | ||
| | | | ||
- | + | == The Experiments == | |
- | == Materials == | + | === Materials === |
- | + | *Backbone Plasmids | |
- | + | **Plasmid pSB3C5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [5C] | |
- | + | **Plasmid pSB3T5 with {{part|BBa_J04450}} : 2009 Kit Plate 1 [9C] | |
- | + | *Promoters | |
- | + | **Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue | |
- | + | *Protein Coding Sequences | |
- | + | **{{part|BBa_E0044|Green fluorescent protein(BBa_E0044)}} : 2009 Kit Plate 1 [14G] | |
- | + | **{{part|BBa_E1010|Red fluorescent protein(BBa_E1010)}} : 2009 Kit Plate 1 [18F] | |
- | + | **Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part] | |
- | + | *Primers | |
- | + | {| style="color:green; background-color:#ffffcc;" cellpadding="3" cellspacing="0" border="1" | |
+ | ! Template | ||
+ | ! Primer | ||
+ | ! Sequence | ||
+ | ! Length(bp) | ||
+ | |- | ||
+ | |rowspan="2"|Plasmid pSB3C5 || pSB3C5_F ||gctgctgttTAATAAtactagtagcggccgctgc ||align="center" |34 | ||
+ | |- | ||
+ | |pSB3C5(+Pars)_R ||taataggtgtgaattttgagttggCtctagaagcggccgcga ||align="center" |42 | ||
+ | |- | ||
+ | |rowspan="2"|Plasmid pSB3T5 ||pSB3T5_F ||gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc ||align="center" |49 | ||
+ | |- | ||
+ | |pSB3T5_R ||GTCGGCAATATGAAGctctagaagcggccgcga ||align="center" |33 | ||
+ | |- | ||
+ | |rowspan="2"|Promoter yodA ||PyodA_F ||cggccgcttctagagCTTCATATTGCCGACAAAGTACG ||align="center" |38 | ||
+ | |- | ||
+ | |PyodA_R ||ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG ||align="center" |38 | ||
+ | |- | ||
+ | |rowspan="4"|Green fluorescent protein ||rowspan="2"|GR(+Pars)_F || aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc ||rowspan="2" align="center" |78 | ||
+ | |- | ||
+ | |gtaaaggagaagaacttttcactg | ||
+ | |- | ||
+ | |rowspan="2"|GR(+Pznt)_R || ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg ||rowspan="2" align="center" |84 | ||
+ | |- | ||
+ | |TCTAGTttattaaacagcagcagcgtagttttcg | ||
+ | |- | ||
+ | |rowspan="4"|Red fluorescent protein | ||
+ | |rowspan="2"|RF(+Pznt)_F || tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG ||rowspan="2" align="center" |75 | ||
+ | |- | ||
+ | |gcttcctccgaagacgttatca | ||
+ | |- | ||
+ | |rowspan="2"|RF(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg ||rowspan="2" align="center" |59 | ||
+ | |- | ||
+ | |agtgacgac | ||
+ | |- | ||
+ | |rowspan="3"|Aryl acylamidase | ||
+ | |AMD_F || CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG ||align="center" |37 | ||
+ | |- | ||
+ | |rowspan="2"|AMD(+AAV tag)_R || TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC ||rowspan="2" align="center" |55 | ||
+ | |- | ||
+ | |CGTCCGGCG | ||
+ | |} | ||
+ | *Chemicals | ||
+ | **Acetaminophen (Sigma) | ||
+ | **CdCl2∙H2O (Junsei) | ||
+ | **ZnCl2 (Sigma) | ||
+ | **KH2AsO3 (Sigma) | ||
+ | **Luria-Bertani broth & Bacto agar (Difco) | ||
+ | **o-Cresol (Sigma) | ||
+ | **CuSO4∙5H2O (Sigma) | ||
|} | |} |
Revision as of 05:38, 20 October 2009
The ExperimentsMaterials
|