Team:KU Seoul/Details

From 2009.igem.org

Revision as of 06:54, 20 October 2009 by Roh329 (Talk | contribs)






The Experiments

Materials

  • Backbone Plasmids
    • Plasmid pSB3C5 with [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] : 2009 Kit Plate 1 [5C]
    • Plasmid pSB3T5 with [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] : 2009 Kit Plate 1 [9C]
  • Promoters
    • Promoter arsR [ParsR], zntA [Pznt] and yodA [PyodA](ref) originated from genomic DNA of Escherichia coli XL-1 Blue
  • Protein Coding Sequences
    • [http://partsregistry.org/Part:BBa_E0044 Green fluorescent protein(BBa_E0044)]  : 2009 Kit Plate 1 [14G]
    • [http://partsregistry.org/Part:BBa_E1010 Red fluorescent protein(BBa_E1010)] : 2009 Kit Plate 1 [18F]
    • Aryl acylamidase protein(ref) : [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=227462445&dopt=GenBank new biological part]
  • Primers
Template Primer Sequence Length(bp)
Plasmid pSB3C5 pSB3C5_F gctgctgttTAATAAtactagtagcggccgctgc 34
pSB3C5(+Pars)_R taataggtgtgaattttgagttggCtctagaagcggccgcga 42
Plasmid pSB3T5 pSB3T5_F gacgaaaactacgctgctgctgttTAATAAtactagtagcggccgctgc 49
pSB3T5_R GTCGGCAATATGAAGctctagaagcggccgcga 33
Promoter yodA PyodA_F cggccgcttctagagCTTCATATTGCCGACAAAGTACG 38
PyodA_R ATGTGACTTACCCATaacAGTTTCCTCCAGAGTCATTG 38
Green fluorescent protein GR(+Pars)_F aattcacacctattaccttcctctgcacttacacattcgttaagtcatatATGc 78
gtaaaggagaagaacttttcactg
GR(+Pznt)_R ctggagtcgactccagagtcaagttttatcagagatacagcgagcggacg 84
TCTAGTttattaaacagcagcagcgtagttttcg
Red fluorescent protein RF(+Pznt)_F tgataaaacttgactctggagtcgactccagagtgtatccttcggttaatATG 75
gcttcctccgaagacgttatca
RF(+AAV tag)_R TTATTAaacagcagcagcgtagttttcgtcgtttgctgcAgcaccggtgg 59
agtgacgac
Aryl acylamidase AMD_F CTGGAGGAAACTGTTatgGGTAAGTCACATTCGCCAG 37
AMD(+AAV tag)_R TTATTAaacagcagcagcgtagttttcgtcgtttgctgcCAGGGGC 55
CGTCCGGCG
  • Chemicals
    • Acetaminophen (Sigma)
    • CdCl2∙H2O (Junsei)
    • ZnCl2 (Sigma)
    • KH2AsO3 (Sigma)
    • Luria-Bertani broth & Bacto agar (Difco)
    • o-Cresol (Sigma)
    • CuSO4∙5H2O (Sigma)

Experiment Dairy

  • 090914
  1. Streaking of E. coli XL-1 Blue
  2. Preparation of LB plate (containing 100μg/ml ampicillin, 12.5μg/ml tetracycline, 50μg/ml kanamycin and 25μg/ml chloramphenicol of final concentration, respectively) & dry in 37℃ incubator for 12 hours
  3. Inoculation of E. coli DH5a to 5ml LB broth for preparation of competent cell
  4. Design of cloning primers & ordering the primers
  • 090915
  1. Inoculation of E. coli XL-1 Blue to 2ml LB broth for genomic DNA extraction
  2. Preparation of E. coli DH5a competent cell (based on BSGC protocol)
  • 090917
  1. Transformation for amplification of BioBrick parts (BBa_E0044, BBa_E1010, pSB3C5 and pSB3T5) (based on BSGC protocol)
  2. Genomic DNA extraction of E. coli XL-1 Blue by AccuPrep® Genomic DNA Extraction Kit
  • 090918
  1. Inoculation of colonies to 2ml LBAmp(BBa_E0044), LBKan(BBa_E1010), LBCm(pSB3C5) and LBTet(pSB3T5) broth


  • 090919
  1. Plasmid extraction of each part by LaboPass™ Mini Plasmid DNA Purification Kit
  2. 0.8% agarose gel electrophoresis (Figure 1)

KU Seoul 1.jpeg

  • 090921
  • PCR of BioBrick Parts
    • General PCR condition : 94℃(3’)-[94℃(1’)-53℃(1’)-72℃(3’)]30-72℃(5’)-4℃
PCR mixture volume (μl)
Template (mini prep. samples of plasmid : aryl acylamidase, rfp, gfp and PyodA) 1
2.5mM dNTP 4
forward-primer (10pmol/μl) 2
reverse-primer (10pmol/μl) 2
10x Synergy™ buffer 5
Synergy™ DNA polymerase [Gene Ctraft Germany] (10U/μl) 0.5
D.W. 35.5
    • Hot start PCR condition : 95℃(15’)-[95℃(1’)-53℃(1’)-72℃(3’)]30-72℃(10’)-4℃
    • Result (Figure 2)

KU Seoul 2.jpg

Retrieved from "http://2009.igem.org/Team:KU_Seoul/Details"