"
Team:Valencia/Notebook/September
From 2009.igem.org
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
September 4th
We have tried our protocol using the fluoriscense microscope.We obtained some interesting results, but finally they were only artifacts. It seems like the the microscope is a good option to "see" our yeasts.
September 11th
Today we have had an iGEM meeting.
We have repited the PCR with new primers:
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’
Programme
After 2 minutes at 94 ºC as a previous step. Every of our 30 cycles has these three steps:
- 45s at 94ºC
- 1min at 60º
- 1min at 72ºC
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
We haven't obtained any result.
September 14th
Trying another PCR...
We have variated the programme another time T-T
Programme
After 3 minutes at 94 ºC as a previous step. Every of our 30 cycles has these trhee steps:
- 30s at 94ºC
- 1min at 55ºC
- 1min at 72ºC
We have added a final step of 7 minutes at 72ºC.
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
Wiiiiiiiiiiiiiiiii!!!!!!!!! We had amplification!!!!! We will use wt 1 microlitre of PCR amplification product (career 1) to build our first BioBrick in the next days.
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input. We didn't obtain any result.
15th September
We have started with bacteria transformation. To build our first BioBrick, we selected the pSB1A3 plasmid located at 1K hole of plate 1 (distributed for the iGEM at spring 2009). We have used a E.coli strain ultracompetent called XL1-Gold. Transformation protocol comes with the strain.
After the steps, we left our strain in incubation, to make them add the plasmid.
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input.
16th September
Our E.coli are transformed. We have a lot of colonies in the 300 microliters spreading culture. They are red.
We have repited another time Arinyo's protocol.
17th September
We couldn't reproduce this time Arinyo's protocol because the preculture didn't grow up.
For other side, we have prepared a preculture of E.coli transformed to do a plasmidic DNA extraccion the following day.
18th September
... And another Arinyo's protocol reproduction... Neverending story... :D
21th September
We have done different things today.
First, we have continued with Arinyo's protocol reproductions.
Second, we have made the plasmidic DNA extraction.
And third, we have prepared new SD medium and SD laking Leu (líquid and with agar).
22th September
Another Arinyo's protocol reproduction... What a novelty!!!
24th September
iGEM meeting and... Dinner&beers!!! What do you think? Scientists don't get fun? ;)
25th September
We have continued with BioBricks tasks: today we have made a digestion. Both extraction product (plasmids) and PCR product (insert) has been digested with EcoRI and XbaI in those quantities: - H20 - H Buffer - 0,5 microliters XbaI - 0,5 microliters EcoRI - plasmid
... And for other side...
- H20 - H Buffer - 0,5 microliters XbaI - 0,5 microliters EcoRI - insert
