Team:Todai-Tokyo/Protocols/Notebook Sample
From 2009.igem.org
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Protocols | Ethics |
---|
MiniprepThe following were miniprepped:
PCRThe yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers: yqiT fwd: agcccgtgtagtactgtagagtt using PCR program 1 and Ex-taq. This PCR reaction attaches a Biobrick prefix and suffix to the gene.
Sequencing
TransformationLigationInfusionGel PurificationRE Digest |