Categories :

Home Team Sponsors Parts Submitted to Registry Image Gallery Leave a Message!

Project :

Overview Sensitivity Tuner --- Characterisation --- Modelling Colour Generators --- Carotenoids (Orange/Red) --- Melanin (Brown) --- Violacein (Purple/Green) The Future Safety

Notebook :

Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10

Team Logistics :

Protocols Stock List Research Shared Links and Help

Week 3 - Development

Monday

Primer Design

Primers were designed to convert MelA into a biobrick. Primers A and F are for either end (including prefix and suffix - highlighted in green). The other primers surround the unwanted restiction sites (highlighted in yellow) with the changed base in red.

Orange Pigment

Used plasmid editor to examine the genes used for the production of orange pigments. The (supposedly) orange-producing pigment from the biobricks:

We also tried a preliminary design for a biobrick we could construct, in case the orange biobrick does not function. This uses the same genetic synthetic pathway for gene consruction:

Transformed Pigments

The MelA plate left on the bench overnight produced a brown-coloured pigment! Growth on media containing IPTG should produce this pigment a lot faster.

Amplification system

Activators

Found parts submitted by Cambridge '07 team amplifier project. Three translational units (ribosome binding sites and protein coding sequence) for the three activators. Sequence below.

Ogr activator from P2 phage: Part I746350

>BBa_I746350 Part-only sequence (237 bp) aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatc atcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgca cccgttgccatcagggcagcaaattatgtggatgtaa

pag activator from PSP3 phage: Part I746351

>BBa_I746351 Part-only sequence (237 bp) aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatc accagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgcccca ccccatcagaaaccaacaacagcaactttggctttga

delta activator from phiR73 phage: Part I746352

>BBa_I746352 Part-only sequence (264 bp) aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatc tccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggc aagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa

Tuesday

Wednesday

Thursday

Friday