Team:Cambridge/Notebook/Week3

From 2009.igem.org

Revision as of 11:25, 27 July 2009 by Mjs88 (Talk | contribs)


Week 3 - Development

Monday

Primer Design

Primers were designed to convert MelA into a biobrick. Primers A and F are for either end (including prefix and suffix - highlighted in green). The other primers surround the unwanted restiction sites (highlighted in yellow) with the changed base in red.

MelA primers.JPG

These correspond to the parts on the gene shown below. The stars correspond to the two unwanted restriction sites.

MelA primer map.JPG

Orange Pigment

Used plasmid editor to examine the genes used for the production of orange pigments. The (supposedly) orange-producing pigment from the biobricks:

Orange biobrick.JPG

We also tried a preliminary design for a biobrick we could construct, in case the orange biobrick does not function. This uses the same genetic synthetic pathway for gene consruction:

EBI.JPG

Transformed Pigments

The MelA plate left on the bench overnight produced a brown-coloured pigment! Growth on media containing IPTG should produce this pigment a lot faster.

Amplification system

Activators

Found parts submitted by Cambridge '07 team amplifier project. Three translational units (ribosome binding sites and protein coding sequence) for the three activators. Sequence below.

Ogr activator from P2 phage: Part I746350


>BBa_I746350 Part-only sequence (237 bp) aaagaggagaaatactagatgtttcattgtcctttatgccagcatgccgcacatgcgcgtacaagtcgctatatcactgacacgacaaaagagcgttatc atcagtgccagaacgtgaattgcagcgccacgttcatcacttatgagtcggtacagcgatacatcgtgaagccgggagaagtccacgccgtaaggccgca cccgttgccatcagggcagcaaattatgtggatgtaa

pag activator from PSP3 phage: Part I746351

>BBa_I746351 Part-only sequence (237 bp) aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatc accagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgcccca ccccatcagaaaccaacaacagcaactttggctttga

delta activator from phiR73 phage: Part I746352

>BBa_I746352 Part-only sequence (264 bp) aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatc tccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggc aagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa

(delete sequence if you think its unnecessary and just leave part names)

promoters Available as individual parts, with a GFP reporter or as part of a composite with the activator upstream. Five promoters as used by Cambridge '07:

PF promoter, part: I746360 PO promoter, part: I746361 PP promoter, part: I746362 Psid promoter, part: I746364 PLL promoter, part: I746365

Tuesday

Wednesday

Thursday

Friday