Team:Todai-Tokyo/Protocols/Notebook Sample

Miniprep

The following were miniprepped:

• pLacI-RFP-dterm (From Ligation on 9/4; 4 colonies)
• RFP ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04450 BBa_J04450] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution]; 6 colonies)

PCR

The yqiT gene was PCR amplified from pLacI-yqiT-dterm (miniprepped on 9/7) using the following primers:

yqiT fwd: agcccgtgtagtactgtagagtt
yqiT rev: agggatgtttgccagtcgtaattag

using PCR program 1 and Ex-taq.

Note: This PCR reaction attaches a Biobrick prefix and suffix to the gene.

Sequencing

The following were sequenced using the labeled primers:

• pAraC Sample 1 (miniprepped on 9/23)
  • 1) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg
  • 2) Biobrick vector rev: tttttaaaagggggtgtgtgtgtaaagttt
• pAraC Sample 2 (miniprepped on 9/23)
  • 3) Biobrick vector fwd: atatgagagcgcgcgcagagagagatg

Results:
1) Sequence read failed
2) Single-base mutation found in sequence that creates stop codon; re-do the ligation
3) Desired Sequence read

Transformation

The following were Transformed into E. coli competent cells:

• pAraC-RBS ([http://partsregistry.org/wiki/index.php?title=Part:BBa_J04451 BBa_J04451] from [http://partsregistry.org/assembly/libraries.cgi?id=19 2009 Spring Distribution])
• pLacI (miniprepped on 9/23)

Ligation + Transformation

The following Ligations were performed using the listed fragments and Transformed into E. coli competent cells:

• pLacI-RBS-yqiT-dterm
  • pLacI-RBS S/P (Digested on 10/1)
  • yqiT-dterm E/X (Digested on 10/1)
• pAraC-RBS-yqiT-dterm
  • pAraC-RBS S/P (Digested on 9/22)
  • yqiT-dterm E/X (Digested on 10/1)

Infusion

Gel Purification

RE Digest

Colony PCR