Team:KULeuven/13 July 2009
From 2009.igem.org
Revision as of 14:38, 13 July 2009 by JochemDeen (Talk | contribs)
Contents |
Project progress
A & B (comparator), ideas
Key/lock system, see [http://parts2.mit.edu/wiki/index.php/Berkeley2006-RiboregulatorsMain Riboregulators (Berkeley 2006)]
Odor synthesis/sensor
- Vanillin synthesis: DNA not yet complete/in library [http://partsregistry.org/wiki/index.php/Part:BBa_I742140]
- Combination of 5 genes; 3 ervan zijn beschikbaar
- [http://parts.mit.edu/igem07/index.php/Edinburgh/Yoghurt/Design#Vanilla_Flavour_Production Edinburgh Vanilla production] (Synthese stappen door Edinburgh igem 2007)
- [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=17437627#id538997 Vanillin production using metabolically engineered Escherichia coli under non-growing conditions], Ferrulic accid --> Vanillin, 5k bp
- Combination of 5 genes; 3 ervan zijn beschikbaar
Light sensor
- YCGF Gene, natural available in [http://ecoliwiki.net/colipedia/index.php/ycgF:Gene 3 E. Coli strains]. Can use the promotor of Ycgf gene for expression
- Probable strain K12
- Promotor voor YCGF gene:
- AACAATCCAGGGTAATGGGTGAGGCGAGAGTAAGACGGTAACAGACATATCTTCTTG TGTCTTTCTTTTAATACCAAAACATAACCGTTTCTTTACATTGATAAAAAATGGAAAAAG TTGAACACTAGTTGGCGAAAAATCTTGTATAGATTGTCAGTTAAATGATGCAATATGTT TTATCATAACACATTGTTTTATATGCATTAGCACTAATTGCAAAAAATTAATTTATCATT CTGTACACATATTTCGTACAAGTTTGCTATTGTTACTTCACTTAACATTGATTAACATTTTTAACAGAGGCGTAGCATG (bron: [www.ncbi.nlm.nih.gov])
Odorless strain of E.coli
- [http://openwetware.org/wiki/IGEM:MIT/2006 MIT 2006] used an indoline defficient strain of E.coli: [http://cgsc.biology.yale.edu/Strain.php?ID=64826 YYC912].
- Knockout of [http://cgsc.biology.yale.edu/Mutation.php?ID=6240 TNAa5-] gene (tryptophanase) in various strains and selected the least 'smelly.'
To do
- Blue light receptor
- Decide on E.Coli strain
- try with K12
- Vector in neural scent (indole knockout)
- Decide on primers (!Pre + suffix!)
- PCR of promotor
- Couple promotor to GFP --> Standard iGEM plasmid
- test!
- Obtain regulation site
- Decide on E.Coli strain
Drylab
[http://www.kuleuven.be/rega/mvr/bookmarktsdl.html BioInformatics bookmarks]
Wiki
- create Ideas page
- Some idiot replaced the example logo Image:Example_logo.png with his own logo, so all references to it were removed from our wiki