"
Team:EPF-Lausanne/Notebook/Cloning Strategy
From 2009.igem.org
Contents |
Cloning strategy
July
06.07.09
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
07.07.09
To design plasmids : software Vector NTI
08.07.09
Inducible LOVTAP biobrick strategy
- Problem to overcome:
- PstI sites in LOVTAP sequence.
- Our goal:
- Biobrick consisted of LacI promoter-RBS-LOVTAP-Term (in this order).
- Material:
- Biobrick of LacI promoter, RBS, LOVTAP, Term seperatedly ( LOVTAP obtained from previous section and the rest from iGEM Spring 2009 distribution Kit plate).
- Strategy:
- LacI promoter-RBS ligation with iGEM protocol (LacI promoter digested with ES, RBS digested with XP, plasmid containing an other antibiotic digested with EP).
- LOVTAP is digested with ES and inserted into Term plasmid (which was digested with EX previously).
- Finally, LacI promoter-RBS digested with ES to be inserted into LOVTAP-Term plasmid, digested with EX.
09.07.09
Partial digestion strategy
- Problem to overcome:
- PstI sites in LOPTAP sequence -> Impossible to use iGEM protocol for ligation (where downstream part must be cut with XP)
- Strategy:
- Cut with X first.
- Divide into several solutions and add different concentrations of P (by dilution series)
- Results:
- Most concentrated tube: all P sites are recognized and cut, so the number of parts diminishes with the concentration value.
- Run an agarose gel and extract the right piece (recognized by the segment's length).
10.07.09
13.07.09
Restriction enzymes on [http://www.neb.com/nebecomm/products/category1.asp?#2 Biolabs website] and [http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp clevage oligonucleotides]
TRP promoter biobrick strategy'
- Problem to overcome:
- SpeI sites on Trp promoter sequence and it's an upstream part which has to be cut with ES.
- Strategy:
- PCR: Forward primer having E and X sites and Reverse primer NheI.
- Digest Trp promoter with E and NheI.
- Digest plasmid with E and X.
- Ligation -> E site is recreated; X and NheI have compatible ends so ligation is possible and the site is destroyed (mixted site).
14.07.09
Primers designed for LOVTAP read-out and RBphP project:
1.Forward primer Trp promoter:
- gtttcttc gaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgc
2.Reverse primer Trp promoter:
- ctagctagctaggtcgataccctttttacgtgaacttgcgtactagttaactagttcgatgattaattgtca
3.1st Forward primer Inverter TetR:
- aatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc
4.2nd Forward primer Inverter TetR:
- gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta
5.Reverse Primer Inverter TetR:
- ctagctagctag tttctcctctttctctagtagtgc
6.Forward primer ppsR1 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatgctggaggatatttgccctggtg
7.Reverse primer ppsR1 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtattactcatcggctccgtctccttc
8.Forward primer ppsR2 R.Palustris CGA009:
- gtttcttcgaattcgcggccgcttctagatggcgtcaaagtccgttcatgcc
9.Reverse primer ppsR2 R.Palustris CGA009:
- gtttcttcctgcagcggccgctactagtatcaatcctctgcgtcgtctgagg
10.Forward primer BrBphP Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgcccgttccgctgacgac
11.Reverse primer BrBphP Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtatcactcctcgctctgcgagc
12.Forward primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatgagggcgttcagagctcc
13.Reverse primer ppsR1 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactattccaactgactgtcttcttcgc
14.Forward primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcgaattcgcggccgcttctagatggccgagtttcacggtccac
15.Reverse primer ppsR2 Bradyrhizobium ORS278:
- gtttcttcctgcagcggccgctactagtactagctccccttttcggtttcctc
