Team:Warsaw/Glossary

This protein is also known as the lambda repressor. cI is sole protein expressed in the lysogenic state of Lambda phage. It act as transcription inhibitor which binds to specific sites in phage genome. At low concentrations blocks the pR promoter (preventing cro production). At high concentrations downregulates its own production through OR3 binding

Cro repressor is a small dimeric protein which binds to specific sites on the DNA of bacteriophage lambda. Fragment of the phage DNA that is recognized by cro is known as cro-box. Recognition of specific DNA binding sites appears to occur via multiple hydrogen bonds between amino acid side chains of the protein and base pair atoms exposed within the major groove of DNA. Cro act as a transcription inhibitor which binds OR3, OR2 and OR1 sites. At low concentrations blocks the pRM promoter preventing cI production. At high concentrations downregulates its own production through OR2 and OR1 binding.

Cro-box is the particular fragment of phage lambda DNA which is recognized by aforementioned cro repressor. In our project we used artificial designed cro-box sequence:

 5' ATCTAGATACCTCTGGCGGTGATACTAGTGT 3'

The enzyme cytochrome c oxidase or Complex IV is a large transmembrane protein complex found in bacteria and the mitochondrion. It is the last enzyme in the respiratory electron transport chain located in the mitochondrial (or bacterial) membrane. It receives an electron from each of four cytochrome c molecules, and transfers them to one oxygen molecule, converting molecular oxygen to two molecules of water. In the process, it binds and translocates four protons across the membrane, helping to establish a transmembrane proton concentration gradient which is crucial for the ATP synthase to synthesize ATP.

endosome is a membrane-bound compartment inside cells which is responsible for the sorting of ematerial previously endocytosed by the cell, before transport to lysosomes. This allows some material to be returned to the plasma membrane.

The green fluorescent protein (GFP) is protein which exhibits intensive green fluorescence when exposed to blue light. Although many other marine organisms have similar green fluorescent proteins, GFP traditionally refers to the protein first isolated from the jellyfish Aequorea victoria. The GFP from A. victoria has a major excitation peak at a wavelength of 395 nm and a minor one at 475 nm. Its emission peak is at 509 nm which is in the lower green portion of the visible spectrum. In the field of cell and molecular biology, the GFP gene is frequently used as a reporter of expression. Many different mutants of GFP have been engineered since their potential for widespread usage. The collection of the mutagenized forms include many color mutants.

Integrins are cellular receptors that mediate attachment between a cell and the tissues surrounding it, which may be other cells or the extracellular matrix (ECM). They are also involved in cell signaling and thereby define cellular shape, mobility, and regulate the cell cycle. Many types of integrin exist, and some cells have multiple types of integrins on their surface. Integrins are of vital importance to all animals and have been found in each investigated animal plylum. Several integrin types are recognized by invasins, bacterial surface proteins which are responsible for entrance of bacterium into the cell.

Internalins are surface proteins found on Listeria monocytogenes. There are two diiferent forms of these proteins, InlA and InlB. Both of them are used by the bacteria to invade mammalian cells via cadherins transmembrane proteins which exist on the cellular membrane. The exact role of these proteins and their invasiveness in vivo is in not yet completely understood. In cultured cells, InlA is necessary to facilitate Listeria entry into human epithelial cells. However InlB is necessary for bacterial cell internalisation in several other cell types, including hepatocytes and fibroblasts.