"
Team:Valencia/Notebook/September
From 2009.igem.org
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
September 4th
We have tried our protocol using the fluoriscense microscope.We obtained some interesting results, but finally they were only artifacts. It seems like the the microscope is a good option to "see" our yeasts.
September 11th
Today we have had an iGEM meeting.
We have repited the PCR with new primers:
Forward: 5'gaattcgcggccgcttctagatgaccagcgaccaatactc 3’
Reverse: 5’tactagtagcggccgctgcagttaggggacagctccaccg 3’
Programme
After 2 minutes at 94 ºC as a previous step. Every of our 30 cycles has these three steps:
- 45s at 94ºC
- 1min at 60º
- 1min at 72ºC
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
We haven't obtained any result.
14th September
Trying another PCR...
We have variated the programme another time T-T
Programme
After 3 minutes at 94 ºC as a previous step. Every of our 30 cycles has these trhee steps:
- 30s at 94ºC
- 1min at 55ºC
- 1min at 72ºC
We have added a final step of 7 minutes at 72ºC.
1 = wt (1 microlitre)
2 = wt (2 microlitres)
3 = Cch1 (1 microlitre)
4 = Mid1 (1 microlitre)
5 = Negative Control
6 = Possitive Control
(We used the same MWM)
Wiiiiiiiiiiiiiiiii!!!!!!!!! We had amplification!!!!! We will use wt 1 microlitre of PCR amplification product (career 1) to build our first BioBrick in the next days.
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input. We didn't obtain any result.
15th September
We have started with bacteria transformation. To build our first BioBrick, we selected the pSB1A3 plasmid located at 1K hole of plate 1 (distributed for the iGEM at spring 2009). We have used a E.coli strain ultracompetent called XL1-Gold. Transformation protocol comes with the strain.
After the steps, we left our strain in incubation, to make them add the plasmid.
For other side, we have prepared Arinyo's protocol only with our wt strain to characterize the behaviour of our yeast with different amounts of KOH as an input.
