"
EPF-Lausanne/6 July 2009
From 2009.igem.org
(→06.07.09) |
|||
| Line 1: | Line 1: | ||
| - | === | + | {{EPF-Lausanne09}} |
| + | <div CLASS="epfltrick">__TOC__ | ||
| + | </div><div CLASS="epfl09"> | ||
| + | |||
| + | ==Wet Lab== | ||
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details). | LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details). | ||
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. | <br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. | ||
| Line 10: | Line 14: | ||
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified | <br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified | ||
| - | + | ==Cloning Strategy== | |
| - | + | ||
| - | == | + | |
Four forward primers were designed to amplify: | Four forward primers were designed to amplify: | ||
<br> 1.Promoter T7, RBS, CBP and LOVTAP: | <br> 1.Promoter T7, RBS, CBP and LOVTAP: | ||
| Line 25: | Line 27: | ||
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc | :gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc | ||
| + | </div><div CLASS="epfl09bouchon"></div> | ||
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1 | The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1 | ||
Revision as of 15:36, 27 July 2009
Contents |
Wet Lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
Cloning Strategy
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
