EPF-Lausanne/6 July 2009
From 2009.igem.org
Line 2: | Line 2: | ||
<div CLASS="epfltrick">__TOC__ | <div CLASS="epfltrick">__TOC__ | ||
</div><div CLASS="epfl09"> | </div><div CLASS="epfl09"> | ||
+ | |||
+ | <html><center> | ||
+ | <font size="6" color="#007CBC"><i>6 July 2009</i></font> | ||
+ | </center></html> | ||
+ | <br> | ||
+ | ---- | ||
+ | <br> | ||
+ | <br> | ||
+ | |||
==Wet Lab== | ==Wet Lab== |
Revision as of 07:08, 28 July 2009
Wet Lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
Cloning Strategy
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
People in the lab
- Tu, Heidi, Rafael, Basile, Nath