EPF-Lausanne/6 July 2009

From 2009.igem.org

(Difference between revisions)
(→06.07.09)
(→People in the lab)
 
(33 intermediate revisions not shown)
Line 1: Line 1:
-
===06.07.09===
+
{{EPF-Lausanne09}}
 +
<div CLASS="epfltrick">__TOC__
 +
</div><div CLASS="epfl09">
 +
 
 +
<html>
 +
<body>
 +
<form action="input_button.htm">
 +
<p align="right">
 +
<input type="button" name="lien" value="7 July 2009"
 +
onClick="self.location.href='https://2009.igem.org/EPF-Lausanne/7_July_2009'">
 +
</p>
 +
</form>
 +
</body>
 +
</html>
 +
 
 +
<html><center>
 +
<font size="6" color="#007CBC"><i>6 July 2009</i></font>
 +
</center></html>
 +
<br>
 +
----
 +
<br>
 +
<br>
 +
 
 +
 
 +
==Wet Lab==
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
Line 11: Line 35:
-
 
+
==Cloning Strategy==
-
===06.07.09===
+
Four forward primers were designed to amplify:
Four forward primers were designed to amplify:
<br> 1.Promoter T7, RBS, CBP and LOVTAP:  
<br> 1.Promoter T7, RBS, CBP and LOVTAP:  
Line 24: Line 47:
One reverse primer were designed:  
One reverse primer were designed:  
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
:gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
-
 
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
 +
 +
 +
==People in the lab==
 +
:Tu, Heidi, Rafael, Basile, Nath
 +
 +
 +
 +
<html><center><a href="https://2009.igem.org/EPF-Lausanne/7_July_2009"><img src="https://static.igem.org/mediawiki/2009/thumb/5/5e/Fleche_droite.png/70px-Fleche_droite.png"></a></center></html>
 +
 +
 +
 +
 +
</div><div CLASS="epfl09bouchon"></div>

Latest revision as of 09:12, 28 July 2009



Contents

6 July 2009




Wet Lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid


Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified


Cloning Strategy

Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg

2.RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag

3.CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag

4.LOVTAP:

gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac

One reverse primer were designed:

gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc

The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1


People in the lab

Tu, Heidi, Rafael, Basile, Nath




Retrieved from "http://2009.igem.org/EPF-Lausanne/6_July_2009"