EPF-Lausanne/6 July 2009

From 2009.igem.org

(Difference between revisions)
(People in the lab)
 
(28 intermediate revisions not shown)
Line 2: Line 2:
<div CLASS="epfltrick">__TOC__
<div CLASS="epfltrick">__TOC__
</div><div CLASS="epfl09">
</div><div CLASS="epfl09">
 +
 +
<html>
 +
<body>
 +
<form action="input_button.htm">
 +
<p align="right">
 +
<input type="button" name="lien" value="7 July 2009"
 +
onClick="self.location.href='https://2009.igem.org/EPF-Lausanne/7_July_2009'">
 +
</p>
 +
</form>
 +
</body>
 +
</html>
 +
 +
<html><center>
 +
<font size="6" color="#007CBC"><i>6 July 2009</i></font>
 +
</center></html>
 +
<br>
 +
----
 +
<br>
 +
<br>
 +
==Wet Lab==
==Wet Lab==
Line 13: Line 33:
<br>-CBP is a small peptide with which we could purify LOVTAP protein
<br>-CBP is a small peptide with which we could purify LOVTAP protein
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
<br>-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
 +
==Cloning Strategy==
==Cloning Strategy==
Line 29: Line 50:
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
The '''recipient IGEM part''' have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1
 +
 +
==People in the lab==
 +
:Tu, Heidi, Rafael, Basile, Nath
 +
 +
 +
 +
<html><center><a href="https://2009.igem.org/EPF-Lausanne/7_July_2009"><img src="https://static.igem.org/mediawiki/2009/thumb/5/5e/Fleche_droite.png/70px-Fleche_droite.png"></a></center></html>
-
----
 
-
;People in the lab: Tu, Heidi, Rafael, Basile, Nath
 
</div><div CLASS="epfl09bouchon"></div>
</div><div CLASS="epfl09bouchon"></div>

Latest revision as of 09:12, 28 July 2009

Contents

6 July 2009





Wet Lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid


Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified


Cloning Strategy

Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg

2.RBS, CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag

3.CBP and LOVTAP:

gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag

4.LOVTAP:

gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac

One reverse primer were designed:

gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc

The recipient IGEM part have been chosen: [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_B0010 BBa_B0010], well 13D in the received kit plate 1


People in the lab

Tu, Heidi, Rafael, Basile, Nath