Team:EPF-Lausanne/Notebook
From 2009.igem.org
(→Notebook) |
(→Notebook) |
||
Line 6: | Line 6: | ||
===06.07.09=== | ===06.07.09=== | ||
;Wet lab: | ;Wet lab: | ||
- | LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following | + | LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details). |
<br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. | <br>One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. | ||
LOVTAP is in a plasmid called pCal-n (see picture below): | LOVTAP is in a plasmid called pCal-n (see picture below): |
Revision as of 16:17, 6 July 2009
Contents |
Notebook
06.07.09
- Wet lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
- Cloning strategy
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM backbone have been chosen: [http://partsregistry.org/Part:pSB3C5 pSB3C5], well 5G in the received kit plate 1
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Lectures | Team Management | References |
---|