Team:EPF-Lausanne/Notebook
From 2009.igem.org
Line 33: | Line 33: | ||
===07.07.09=== | ===07.07.09=== | ||
+ | ;Remark for the notebook: | ||
+ | First, it's great you already started to use the wiki and customised the menu!<br> Then I think we should add the name of the people who worked on each part of a process. It would be easier when people in the lab change.<br> | ||
+ | For the wiki in general, as you did in this page, it is much easier not to use html tags.<br> | ||
+ | We will have a meeting for the modeling on tuesday, I will come to the lab before.<br><br> | ||
;Wet lab: | ;Wet lab: | ||
Revision as of 20:31, 6 July 2009
Contents |
Notebook
06.07.09
- Wet lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli following received protocol, and grown overnight (see Lab book for more details).
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
- Cloning strategy
Four forward primers were designed to amplify:
1.Promoter T7, RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2.RBS, CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3.CBP and LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4.LOVTAP:
- gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed:
- gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
The recipient IGEM backbone have been chosen: pSB3C5, well 5G in the received kit plate 1
07.07.09
- Remark for the notebook
First, it's great you already started to use the wiki and customised the menu!
Then I think we should add the name of the people who worked on each part of a process. It would be easier when people in the lab change.
For the wiki in general, as you did in this page, it is much easier not to use html tags.
We will have a meeting for the modeling on tuesday, I will come to the lab before.
- Wet lab
- Cloning strategy
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Lectures | Team Management | References |
---|