Team:EPF-Lausanne/Notebook
From 2009.igem.org
Contents |
Notebook
06.07.09
- Wet lab
LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli, and grown overnight.
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl.
LOVTAP is in a plasmid called pCal-n (see picture below):
Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified
- Cloning strategy
Four forward primers were designed to amplify:
- Promoter T7, RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
- RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
- CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
- LOVTAP: gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac
One reverse primer were designed: gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc
Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook | Lectures | Team Management | References |
---|