Notebook

06.07.09

Wet lab

LOVTAP plasmid AND TrpR plasmid were transformed in competent E. Coli, and grown overnight.
One problem: we actually don't know TrpR plasmid resistance, so we tried with three resistances available in the lab: Amp., Kana. and Chl. LOVTAP is in a plasmid called pCal-n (see picture below):

pCal-n plasmid

Some comments on the plasmid:
-CBP is a small peptide with which we could purify LOVTAP protein
-Thrombin target is a nucleotidic sequence that can be recognized by thrombin a peptidase. This peptidase will cut CBP once LOVTAP is purified

Cloning strategy

Four forward primers were designed to amplify:

1. Promoter T7, RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtaatacgactcactataggggaattgtg
2. RBS, CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagagtgtttaactttaagaaggag
3. CBP and LOVTAP: gtttcttcgaattcgcggccgcttctagatgaagcgacgatggaaaaagaatttcatag
4. LOVTAP: gtttcttcgaattcgcggccgcttctagatgctactacacttgaacgtattgagaagaac

One reverse primer were designed: gtttcttcctgcagcggccgctactagtatcaatcgcttttcagcaacacctcttc