Revision as of 21:12, 21 October 2009

Meetings Calendar

Promoter Library

Introduction

In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.

Several efforts to produce parts libraries are currently underway.As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.

Novelty in this sub-project

A library of promoters with different strengths would be very useful for engineering biological devices. Promoters' strength can be compared with their PoPS values. However measuring the PoPS is not a trivial process. We can instead meausure their strengths relatively.

Design

Template used to create the promoter sequences: Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix

BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
UpSpacer - attta - consensus sigA 5 bases 5'
-35 - TTGACA
PromSpacer - length 17 - consensus ttttatttaaattatga
-10 - TATAAT
DownSpacer (from ackA)- ggaaaag
BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag

Variances

We designed three variances to create library of promoters with different strengths.

Degenerating -35 and -10 sequences.

 BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix

BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix

Variance 1

In this variance we only degenerate -35 and -10 sequences.

Variance 2

In the second variance we use N's for the promoter sequence between -35 and -10 regions

@@ Line 40: / Line 40: @@
 # BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
 # BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
 ====Variance 1 ====
@@ Line 47: / Line 48: @@
 [[Image:Team_Newcastle_iGEM_Promoter_Library4.png|500px]]
 ====Variance 2 ====
@@ Line 52: / Line 54: @@
 [[Image:Team_Newcastle_iGEM_Promoter_Library5.png|500px]]
+[[Image:Team_Newcastle_iGEM_Promoter_Library7.png|500px]]
 ====Variance 3 ====

Team:Newcastle/Promoter Library

From 2009.igem.org