Team:SupBiotech-Paris/Biobricks

From 2009.igem.org

(Difference between revisions)
 
(30 intermediate revisions not shown)
Line 1: Line 1:
-
{{Template:Supbiotechcss.css}}
+
{{Template:Supbiotechcss15.css}}
{{Template:SupbiotechparisEn}}
{{Template:SupbiotechparisEn}}
 +
<html>
 +
<div style="float: right; margin-right: -92px;">
 +
<a href="https://2009.igem.org/Team:SupBiotech-Paris/Material_%26_Method#drapeau" target="_self">
 +
<img title="Let's go to the next page !" style="width: 75px;" src="https://static.igem.org/mediawiki/2009/e/e9/Suivant.png";>
 +
</a></div>
 +
</html>
{|
{|
 +
|- style="background: grey; color:white; text-align: center; font-weight:bold; border:1px;"
 +
|width=100px height=40px|BioBricks
 +
|width=650px|Description
-
|- style="background: white; color:black; text-align: center; font-weight:bold; border:1"
+
|- style="background: white; color:black; text-align: left;"
-
|width=50px height=40px|BioBricks
+
|B0014 + J23100 : BBa_K292000 [http://partsregistry.org/Part:BBa_K292000]
-
|width=500px|Description
+
|This part contains a double terminator and a constitutive prokaryotic promoter. It is a simple promoter in the goal to begin gene transcription. This part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.<br>
-
|-
+
 
-
| B0014 + J23100
+
|- style="background: #C0C0C0;; color:black; text-align: left;"
-
| This part contains a double terminator and a constitutive prokaryotic promoter. It is a simple promoter in the goals to begin gene transcription. For Sup’biotech-Paris (2009) team this part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.  
+
|B0014 + J23100 + B0030 : BBa_K292001 [http://partsregistry.org/Part:BBa_K292001]
-
|-
+
|This part contains a double terminator, a constitutive prokaryotic promoter and a strong RBS (BBa_B0014 + BBa_J23100 + BBa_B0030). It is a simple promoter in the goal to begin gene transcription. This part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.
-
| B0014 + J23100 + B0030  
+
-
| This part contains a double terminator and a constitutive prokaryotic promoter and a strong RBS (BBa_B0014 + BBa_J23100 + BBa_B0030). It is a simple promoter in the goals to begin gene transcription. For Sup’biotech-Paris (2009) team this part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.
+
|-
|-
-
| R0010 + B0030  
+
|R0010 + B0030 : BBa_K292002 [http://partsregistry.org/Part:BBa_K292002]
-
| This part contains the pLac promoter and a ribosome binding site (BBa_R0010 + BBa_B0030). The Lac promoter is constitutively activated, but it can be repressed by the Lac I repressor from E.coli. This promoter is really useful to control a gene expression by inactivating it with LacI repressor. When LacI is absent the gene should be expressed, and in the presence of LacI, pLac is inhibited. So this part is really suitable for gene expression control by inactivation of pLac with LacI.  
+
|This part contains the pLac promoter and a ribosome binding site (BBa_R0010 + BBa_B0030). The Lac promoter is constitutively activated, but it can be repressed by the Lac I repressor from <i>E.coli</i>. This promoter is really useful to control a gene expression by inactivating it with LacI repressor. When LacI is absent the gene should be expressed, and in the presence of LacI, pLac is inhibited. So this part is really suitable for gene expression control by inactivation of pLac with LacI.  
We can use this part to control a failed feedback mechanism which induces the Lambda phage lytic cycle (Link plasmide Wiki).  
We can use this part to control a failed feedback mechanism which induces the Lambda phage lytic cycle (Link plasmide Wiki).  
In E.coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).  
In E.coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).  
This part already contains a strong RBS to begin directly a gene transcription.  
This part already contains a strong RBS to begin directly a gene transcription.  
-
|-
+
|- style="background: #C0C0C0;; color:black; text-align: left;"
-
| P1003 + B0014
+
|P1003 + B0014 : BBa_K292003 [http://partsregistry.org/Part:BBa_K292003]
-
| This part contains a kanamycin resistance cassette and a double terminator (BBa_P1003 + BBa_B0014). This allows the kanamycin cassette to be functional.  
+
|This part contains a kanamycin resistance cassette and a double terminator (BBa_P1003 + BBa_B0014). This allows the kanamycin cassette to be functional.  
The cassette can be used to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage.  
The cassette can be used to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage.  
In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin.  
In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin.  
This part is completed by B0014 + P1003 + B0014 to finish the transcription before the resistance cassette.
This part is completed by B0014 + P1003 + B0014 to finish the transcription before the resistance cassette.
 +
|-
|-
-
| B0014 + P1003 + B0014  
+
|B0014 + P1003 + B0014 : BBa_K292004 [http://partsregistry.org/Part:BBa_K292004]
-
| This part contains a double terminator and a functional kanamycin resistance cassette (promoter, resistance against kanamycin and a double terminator). It is reliable to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage.  
+
|This part contains a double terminator and a functional kanamycin resistance cassette (promoter, resistance against kanamycin and a double terminator). It is reliable to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage.  
In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin.  
In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin.  
We can use this part as a reporter, or as a simple resistance cassette.  
We can use this part as a reporter, or as a simple resistance cassette.  
The double terminator allows the RNA translation arrest before the resistance cassette, so this is already created to insert a coding gene with its RBS before the resistance cassette.
The double terminator allows the RNA translation arrest before the resistance cassette, so this is already created to insert a coding gene with its RBS before the resistance cassette.
-
|-
+
 
-
| C0012 + B0014
+
|- style="background: #C0C0C0;; color:black; text-align: left;"
-
| This part contains a LacI repressor and a terminator (BBa_C0012 + BBa_B0014). The LacI repressor repressed pLac promoter from the E.coli lactose operon. So LacI repressor is really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI and creates a failed feedback mechanism for pLac inhibition.  
+
|C0012 + B0014 : BBa_K292005 [http://partsregistry.org/Part:BBa_K292005]
 +
|This part contains a LacI repressor and a terminator (BBa_C0012 + BBa_B0014). The LacI repressor repressed pLac promoter from the E.coli lactose operon. So LacI repressor is really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI and creates a failed feedback mechanism for pLac inhibition.  
History:  
History:  
In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).  
In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).  
 +
|-
|-
-
| B0030 + C0012 + B0014  
+
|B0030 + C0012 + B0014 : BBa_K292006 [http://partsregistry.org/Part:BBa_K292006]
|This part contains a strong ribosome binding site, the LacI repressor and a double terminator (BBa_B0030 + BBa_C0012 + BBa_B0014). This brick comes from the BBa_K292005. The LacI repressor represses pLac promoter from the E.coli lactose operon. So LacI repressor and this bio-brick are really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI by using another operon as the tetracycline operon and creates a failed feedback mechanism for pLac inhibition and so, for gene expression inhibition.
|This part contains a strong ribosome binding site, the LacI repressor and a double terminator (BBa_B0030 + BBa_C0012 + BBa_B0014). This brick comes from the BBa_K292005. The LacI repressor represses pLac promoter from the E.coli lactose operon. So LacI repressor and this bio-brick are really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI by using another operon as the tetracycline operon and creates a failed feedback mechanism for pLac inhibition and so, for gene expression inhibition.
The LacI (BBa_K292006) already contains a strong RBS and a double terminator, so this brick is ready to use!
The LacI (BBa_K292006) already contains a strong RBS and a double terminator, so this brick is ready to use!
History:  
History:  
In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).
In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).
-
|-
+
 
-
| BBa_I712669 + BBa_B0014
+
|- style="background: #C0C0C0;; color:black; text-align: left;"
-
| This part contains a green fluorescence protein (GFP) under control of a CMV promoter and its double terminator (BBa_I712669 + BBa_B0014). This part is reliable to use when we want to know if a gene is inserted into a eukaryotic cell. For example we can use it when we design a recombinant virus. In fact we inserted this bio-brick into the synthetic virus; finally we are able to see if the virus can infect the targeted cells.
+
|BBa_I712669 + BBa_B0014 : BBa_K292007 [http://partsregistry.org/Part:BBa_K292007]
 +
|This part contains a green fluorescence protein (GFP) under control of a CMV promoter and its double terminator (BBa_I712669 + BBa_B0014). This part is reliable to use when we want to know if a gene is inserted into a eukaryotic cell. For example we can use it when we design a recombinant virus. In fact we inserted this bio-brick into the synthetic virus; finally we are able to see if the virus can infect the targeted cells.
This bio-brick already contains a terminator, so it is ready to use.  
This bio-brick already contains a terminator, so it is ready to use.  
 +
|-
|-
-
| BBa_K292008  
+
|BBa_K292008 [http://partsregistry.org/Part:BBa_K292008]
-
| This part contains a SV40 nucleus targeting sequence (DTS). This part is reliable to use to increase the level of gene transfection efficiency.
+
|This part contains a SV40 nucleus targeting sequence (DTS). This part is reliable to use to increase the level of gene transfection efficiency.
Any plasmid will rarely reach the nucleus if we do not provide to it, the necessary element to trigger a mechanism of nuclear incorporation. Studies were conducted on the use of specific sequences for nuclear import of genetic sequences: DTS sequences (DNA Nuclear Targeting Sequence). This bio-brick is able to play this role.
Any plasmid will rarely reach the nucleus if we do not provide to it, the necessary element to trigger a mechanism of nuclear incorporation. Studies were conducted on the use of specific sequences for nuclear import of genetic sequences: DTS sequences (DNA Nuclear Targeting Sequence). This bio-brick is able to play this role.
Sequence:
Sequence:
Line 56: Line 68:
This sequence, known for having the ability to bind to 10 different transcription factors, provides the transportation of DNA to the nucleus. Added to the therapeutic plasmid, this sequence ensures the entry and the expression of therapeutic plasmid into the nucleus of the target cell.
This sequence, known for having the ability to bind to 10 different transcription factors, provides the transportation of DNA to the nucleus. Added to the therapeutic plasmid, this sequence ensures the entry and the expression of therapeutic plasmid into the nucleus of the target cell.
-
|-
+
|- style="background: #C0C0C0;; color:black; text-align: left;"
-
| Bba_K292009  
+
|Bba_K292009 [http://partsregistry.org/Part:BBa_K292009]
-
| This part contains a gene coding for the Stem cell factor (SCF) or c-kit-ligand. Stem cell factor (SCF) is a growth factor that stimulates the survival, proliferation, and differentiation of hematopoietic cells. It is also a specific marker for Stem cells. When binding to c-kit, the c-kit ligand induces the c-kit dimerization and the particle encapsidation. So this is a reliable ligand to transfect a gene into stem cells.
+
|This part contains a gene coding for the Stem cell factor (SCF) or c-kit-ligand. Stem cell factor (SCF) is a growth factor that stimulates the survival, proliferation, and differentiation of hematopoietic cells. It is also a specific marker for Stem cells. When binding to c-kit, the c-kit ligand induces the c-kit dimerization and the particle encapsidation. So this is a reliable ligand to transfect a gene into stem cells.
-
Sequence:
+
-
5’ – ATGAAGAAGACACAAACTTGGATTCTCACTTGCATTTATCTTCAGCTGCTCCTATTTAATCCTCTCGTCAAAACTGAAGGGATCTGCAGGAATCGTGTGACTAATAATGTAAAAGACGTCACTAAATTGGTGGCAAATCTTCCAAAAGACTACATGATAACCCTCAAATATGTCCCCGGGATGGATGTTTTGCCAAGTCATTGTTGGATAAGCGAGATGGTAGTACAATTGTCAGACAGCTTGACTGATCTTCTGGACAAGTTTTCAAATATTTCTGAAGGCTTGAGTAATTATTCCATCATAGACAAACTTGTGAATATAGTGGATGACCTTGTGGAGTGCGTGAAAGAAAACTCATCTAAGGATCTAAAAAAATCATTCAAGAGCCCAGAACCCAGGCTCTTTACTCCTGAAGAATTCTTTAGAATTTTTAATAGATCCATTGATGCCTTCAAGGACTTTGTAGTGGCATCTGAAACTAGTGATTGTGTGGTTTCTTCAACATTAAGTCCTGAGAAAGATTCCAGAGTCAGTGTCACAAAACCATTTATGTTACCCCCTGTTGCAGCCAGCTCCCTTAGGAATGACAGCAGTAGCAGTAATAGGAAGGCCAAAAATCCCCCTGGAGACTCCAGCCTACACTGGGCAGCCATGGCATTGCCAGCATTGTTTTCTCTTATAATTGGCTTTGCTTTTGGAGCCTTATACTGGAAGAAGAGACAGCCAAGTCTTACAAGGGCAGTTGAAAATATACAAATTAATGAAGAGGATAATGAGATAAGTATGTTGCAAGAGAAAGAGAGAGAGTTTCAAGAAGTGTAA – 3’
+
|-
|-
-
| BBa_K292010
+
|BBa_K292010 [http://partsregistry.org/Part:BBa_K292010]
-
| This part contains the D protein from the Lambda phage. The lambda phage wild type has on its capsid, the D protein, which is in charge of the stabilization of the entire capsid. The D protein is exposed on the entire outer surface of the capsid, so this protein is an ideal candidate to be fused to a cellular internalization protein.
+
|This part contains the D protein from the Lambda phage. The lambda phage wild type has on its capsid, the D protein, which is in charge of the stabilization of the entire capsid. The D protein is exposed on the entire outer surface of the capsid, so this protein is an ideal candidate to be fused to a cellular internalization protein.
-
 
+
The D protein is organized as a trimer. Each monomer is distant of 5,1nm in a trimer. The crystal structure of the protein D, as a trimeric form, shows that the Nter and Cter ends, are exposed at the capsid surface, and are very closed from each other. The Nter and Cter ends are exposed at the mature capsid surface, which allows the choice for the location of the fusion protein (Nter or Cter). However, several studies have showed that the fusion to the Cter end, allows better results.
The D protein is organized as a trimer. Each monomer is distant of 5,1nm in a trimer. The crystal structure of the protein D, as a trimeric form, shows that the Nter and Cter ends, are exposed at the capsid surface, and are very closed from each other. The Nter and Cter ends are exposed at the mature capsid surface, which allows the choice for the location of the fusion protein (Nter or Cter). However, several studies have showed that the fusion to the Cter end, allows better results.
-
 
-
 
So the D protein can be used to perform a fusion protein. The internalization protein, called polypeptide III, is issued of the adenovirus penton base. It can be used to design a recombinant Lambda phage able to infect eukaryotic cells.
So the D protein can be used to perform a fusion protein. The internalization protein, called polypeptide III, is issued of the adenovirus penton base. It can be used to design a recombinant Lambda phage able to infect eukaryotic cells.
-
 
This sequence comes from the Lambda phage genomic DNA. It has been amplified by PCR and introduced into a plasmid which comes from the registry.
This sequence comes from the Lambda phage genomic DNA. It has been amplified by PCR and introduced into a plasmid which comes from the registry.
 +
We have some problem to find the best primers annealing temperature. And we performed a lot of trial to introduce it into a plasmid.
-
We have some problem to find the best primers annealing temperature. And we performed a lot of trial to introduce it into a plasmid.
+
|- style="background: grey; color:white; text-align: center; font-weight:bold; border:1px;"
 +
|width=100px height=10px|
 +
|width=650px|
|}
|}

Latest revision as of 02:18, 22 October 2009

framless


BioBricks Description
B0014 + J23100 : BBa_K292000 [http://partsregistry.org/Part:BBa_K292000] This part contains a double terminator and a constitutive prokaryotic promoter. It is a simple promoter in the goal to begin gene transcription. This part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.
B0014 + J23100 + B0030 : BBa_K292001 [http://partsregistry.org/Part:BBa_K292001] This part contains a double terminator, a constitutive prokaryotic promoter and a strong RBS (BBa_B0014 + BBa_J23100 + BBa_B0030). It is a simple promoter in the goal to begin gene transcription. This part is used when adding to a recombinant lambda phage and to begin the transcription of synthetic genes inside the Lambda phage genome.
R0010 + B0030 : BBa_K292002 [http://partsregistry.org/Part:BBa_K292002] This part contains the pLac promoter and a ribosome binding site (BBa_R0010 + BBa_B0030). The Lac promoter is constitutively activated, but it can be repressed by the Lac I repressor from E.coli. This promoter is really useful to control a gene expression by inactivating it with LacI repressor. When LacI is absent the gene should be expressed, and in the presence of LacI, pLac is inhibited. So this part is really suitable for gene expression control by inactivation of pLac with LacI.

We can use this part to control a failed feedback mechanism which induces the Lambda phage lytic cycle (Link plasmide Wiki). In E.coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside). This part already contains a strong RBS to begin directly a gene transcription.

P1003 + B0014 : BBa_K292003 [http://partsregistry.org/Part:BBa_K292003] This part contains a kanamycin resistance cassette and a double terminator (BBa_P1003 + BBa_B0014). This allows the kanamycin cassette to be functional.

The cassette can be used to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage. In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin. This part is completed by B0014 + P1003 + B0014 to finish the transcription before the resistance cassette.

B0014 + P1003 + B0014 : BBa_K292004 [http://partsregistry.org/Part:BBa_K292004] This part contains a double terminator and a functional kanamycin resistance cassette (promoter, resistance against kanamycin and a double terminator). It is reliable to design a recombinant vector by gene insertion in a non lytic bacteriophage as the Lambda phage.

In fact it allows us to know if a bacteriophage is modified or not and if the inserted gene is expressed or not. When the virus is modified the kanamycin cassette induces a kanamycin resistance, so the bacteria become resistance, and when the virus is not modified bacteria are killed by kanamycin. We can use this part as a reporter, or as a simple resistance cassette. The double terminator allows the RNA translation arrest before the resistance cassette, so this is already created to insert a coding gene with its RBS before the resistance cassette.

C0012 + B0014 : BBa_K292005 [http://partsregistry.org/Part:BBa_K292005] This part contains a LacI repressor and a terminator (BBa_C0012 + BBa_B0014). The LacI repressor repressed pLac promoter from the E.coli lactose operon. So LacI repressor is really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI and creates a failed feedback mechanism for pLac inhibition.

History: In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).

B0030 + C0012 + B0014 : BBa_K292006 [http://partsregistry.org/Part:BBa_K292006] This part contains a strong ribosome binding site, the LacI repressor and a double terminator (BBa_B0030 + BBa_C0012 + BBa_B0014). This brick comes from the BBa_K292005. The LacI repressor represses pLac promoter from the E.coli lactose operon. So LacI repressor and this bio-brick are really reliable to use when we want to control a gene expression by using pLac promoter. In fact when LacI is not expressed, pLac is activated, and when there is an expression of LacI, pLac is inhibited. We can easily design a system to induce the transcription of LacI by using another operon as the tetracycline operon and creates a failed feedback mechanism for pLac inhibition and so, for gene expression inhibition.

The LacI (BBa_K292006) already contains a strong RBS and a double terminator, so this brick is ready to use! History: In E.Coli, pLac is a part of the lactose operon. LacI is constantly expressed and represses the pLac. In the presence of Lactose, LacI is inhibited and pLac is active and allows the transcription of beta-galactosidase. Lactose can be substituted by IPTG (Isopropyl β-D-1-thiogalactopyranoside).

BBa_I712669 + BBa_B0014 : BBa_K292007 [http://partsregistry.org/Part:BBa_K292007] This part contains a green fluorescence protein (GFP) under control of a CMV promoter and its double terminator (BBa_I712669 + BBa_B0014). This part is reliable to use when we want to know if a gene is inserted into a eukaryotic cell. For example we can use it when we design a recombinant virus. In fact we inserted this bio-brick into the synthetic virus; finally we are able to see if the virus can infect the targeted cells.

This bio-brick already contains a terminator, so it is ready to use.

BBa_K292008 [http://partsregistry.org/Part:BBa_K292008] This part contains a SV40 nucleus targeting sequence (DTS). This part is reliable to use to increase the level of gene transfection efficiency.

Any plasmid will rarely reach the nucleus if we do not provide to it, the necessary element to trigger a mechanism of nuclear incorporation. Studies were conducted on the use of specific sequences for nuclear import of genetic sequences: DTS sequences (DNA Nuclear Targeting Sequence). This bio-brick is able to play this role. Sequence: 5’ GCATGCTTTG CATACTTCTG CCTGCTGGGG AGCCTGGGGA CTTTCCACAC CCTAACTGAC ACACATTCCA CAGCTGGTTC TTTCCGCCTC AGAAGGTACC T 3’ This sequence, known for having the ability to bind to 10 different transcription factors, provides the transportation of DNA to the nucleus. Added to the therapeutic plasmid, this sequence ensures the entry and the expression of therapeutic plasmid into the nucleus of the target cell.

Bba_K292009 [http://partsregistry.org/Part:BBa_K292009] This part contains a gene coding for the Stem cell factor (SCF) or c-kit-ligand. Stem cell factor (SCF) is a growth factor that stimulates the survival, proliferation, and differentiation of hematopoietic cells. It is also a specific marker for Stem cells. When binding to c-kit, the c-kit ligand induces the c-kit dimerization and the particle encapsidation. So this is a reliable ligand to transfect a gene into stem cells.
BBa_K292010 [http://partsregistry.org/Part:BBa_K292010] This part contains the D protein from the Lambda phage. The lambda phage wild type has on its capsid, the D protein, which is in charge of the stabilization of the entire capsid. The D protein is exposed on the entire outer surface of the capsid, so this protein is an ideal candidate to be fused to a cellular internalization protein.

The D protein is organized as a trimer. Each monomer is distant of 5,1nm in a trimer. The crystal structure of the protein D, as a trimeric form, shows that the Nter and Cter ends, are exposed at the capsid surface, and are very closed from each other. The Nter and Cter ends are exposed at the mature capsid surface, which allows the choice for the location of the fusion protein (Nter or Cter). However, several studies have showed that the fusion to the Cter end, allows better results. So the D protein can be used to perform a fusion protein. The internalization protein, called polypeptide III, is issued of the adenovirus penton base. It can be used to design a recombinant Lambda phage able to infect eukaryotic cells. This sequence comes from the Lambda phage genomic DNA. It has been amplified by PCR and introduced into a plasmid which comes from the registry. We have some problem to find the best primers annealing temperature. And we performed a lot of trial to introduce it into a plasmid.


Back to top


Retrieved from "http://2009.igem.org/Team:SupBiotech-Paris/Biobricks"