Team:Newcastle/Promoter Library
From 2009.igem.org
(→Variances) |
(→Progress) |
||
(19 intermediate revisions not shown) | |||
Line 4: | Line 4: | ||
__NOTOC__ | __NOTOC__ | ||
=Promoter Library= | =Promoter Library= | ||
- | + | Please click on the following links to learn more about the promoter library sub-project: | |
+ | <br> | ||
+ | *[[#Introduction|Introduction]] | ||
+ | *[[#Novelty in this sub-project|Novelty in this sub-project]] | ||
+ | *[[#Design|Design]] | ||
+ | *[[#Lab Work Strategies|Lab Work Strategies]] | ||
+ | *[[#Progress|Progress and Lab Work]] | ||
==Introduction== | ==Introduction== | ||
+ | In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement ''in vivo''. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions. | ||
- | + | Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for ''B. subtilis''. | |
- | + | <br> | |
==Novelty in this sub-project== | ==Novelty in this sub-project== | ||
The novelty in this sub-project lies in the generation of a large number of ''B. subtilis'' promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in ''B. subtilis''. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences. | The novelty in this sub-project lies in the generation of a large number of ''B. subtilis'' promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in ''B. subtilis''. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences. | ||
- | + | <br> | |
+ | ==Design== | ||
Template used to create the promoter sequences: | Template used to create the promoter sequences: | ||
Line 33: | Line 41: | ||
* '''BBSuffix''' - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag | * '''BBSuffix''' - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag | ||
- | === | + | ===Variants=== |
- | We designed three | + | We designed three degenerate sequences to create a library of promoters which we hope will have different strengths. |
- | + | ====Variant 1 ==== | |
+ | In this variant we only modified the -35 and -10 consensus sequences. | ||
- | |||
- | |||
- | |||
BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix | BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix | ||
Line 48: | Line 54: | ||
- | ==== | + | ====Variant 2 ==== |
- | In the second | + | In the second variant we modified the promoter sequence between the -35 and -10 regions. |
+ | |||
BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix | BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix | ||
Line 57: | Line 64: | ||
- | ==== | + | ====Variant 3 ==== |
- | In the third | + | In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region. |
BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix | BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix | ||
Line 64: | Line 71: | ||
[[Image:Team_Newcastle_iGEM_Promoter_Library6.png|500px]] | [[Image:Team_Newcastle_iGEM_Promoter_Library6.png|500px]] | ||
+ | |||
+ | <br> | ||
==Lab Work Strategies== | ==Lab Work Strategies== | ||
Line 73: | Line 82: | ||
* Cut pSB1AT3 vector using EcoR1 and Pst1 | * Cut pSB1AT3 vector using EcoR1 and Pst1 | ||
* Ligate the insert and the plasmid backbone, and transform ''E. coli'' DH5alpha | * Ligate the insert and the plasmid backbone, and transform ''E. coli'' DH5alpha | ||
- | * Subclone into Bacillus integration vector with gfp and insert at amyE | + | * Subclone into ''Bacillus'' integration vector with gfp and insert at ''amyE'' |
+ | |||
+ | <br> | ||
+ | ==Progress== | ||
+ | The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised. | ||
+ | <br> | ||
+ | This is all of the lab work in which the Promoter Library team attempted to construct the promoter library - click on the dates to read that day's lab entry: | ||
+ | <br> | ||
+ | {| class=wikitable border="1" | ||
+ | |- | ||
+ | ! colspan="2" | Summary of Lab Sessions for Promoter Library | ||
+ | |- | ||
+ | | <center>'''Date'''</center> | ||
+ | | <center>'''Description'''</center> | ||
+ | |- | ||
+ | | '''[https://2009.igem.org/Team:Newcastle/Labwork/26_August_2009#Promoter_Library_Sub-project 26th August 2009]''' | ||
+ | | Digested 15ul of ''pGFP-rrnB'' plasmid with ''NheI'' and ''EcoRI'' | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/27_August_2009#Promoter_Library_Sub-Project 27th August 2009]''' | ||
+ | | Attempted to remove the pGFP-rrnB backbone fragment (digested yesterday) from agarose gel - yesterday's digests didn't work properly so second attempt made. Nonetheless, backbone fragment excised from gel and cleaned up | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/28_August_2009#Promoter_Library_Sub-Project 28th August 2009]''' | ||
+ | | Ran 10ul of pGFP-rrnB treated with EcoRI and 10ul of pGFP-rrnB + NheI on some agarose gel for analysis. Additionally, 5ul of the 8Kb pGFP-rrnB digest fragment was ran on gel. | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/1_September_2009#Promoter_Library_Sub-Project 1st September 2009]''' | ||
+ | | Attempted to amplify the three sets of sigA promoter using PCR | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/2_September_2009#Promoter_Library_Sub-Project 2nd September 2009]''' | ||
+ | | Carried out two DNA gel electrophoresis attempts in analysing the 3 variant sets of sigA promoters - both gel photographs show negative results | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/3_September_2009#Promoter_Library_Sub-Project 3rd September 2009]''' | ||
+ | | Cleaned up the PCR products for another run of DNA gel electrophoresis tomorrow. | ||
+ | |- | ||
+ | |'''[https://2009.igem.org/Team:Newcastle/Labwork/4_September_2009#Promoter_Library_Sub-Project 4th September 2009]''' | ||
+ | |C0, V1, V2 and V3 PCR products analysis | ||
+ | |- | ||
+ | |} | ||
{{:Team:Newcastle/Footer}} | {{:Team:Newcastle/Footer}} | ||
{{:Team:Newcastle/Right}} | {{:Team:Newcastle/Right}} |
Latest revision as of 03:04, 22 October 2009
Promoter Library
Please click on the following links to learn more about the promoter library sub-project:
Introduction
In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.
Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.
Novelty in this sub-project
The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.
Design
Template used to create the promoter sequences:
Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix
- BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
- UpSpacer - attta - consensus sigA 5 bases 5'
- -35 - TTGACA
- PromSpacer - length 17 - consensus ttttatttaaattatga
- -10 - TATAAT
- DownSpacer (from ackA)- ggaaaag
- BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag
Variants
We designed three degenerate sequences to create a library of promoters which we hope will have different strengths.
Variant 1
In this variant we only modified the -35 and -10 consensus sequences.
BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix
Variant 2
In the second variant we modified the promoter sequence between the -35 and -10 regions.
BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
Variant 3
In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region.
BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
Lab Work Strategies
- Synthesis other strand using polymerase and a primer
- Cut promoter fragments using EcoR1 and Pst1
- Cut pSB1AT3 vector using EcoR1 and Pst1
- Ligate the insert and the plasmid backbone, and transform E. coli DH5alpha
- Subclone into Bacillus integration vector with gfp and insert at amyE
Progress
The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised.
This is all of the lab work in which the Promoter Library team attempted to construct the promoter library - click on the dates to read that day's lab entry:
Summary of Lab Sessions for Promoter Library | |
---|---|
| |
26th August 2009 | Digested 15ul of pGFP-rrnB plasmid with NheI and EcoRI |
27th August 2009 | Attempted to remove the pGFP-rrnB backbone fragment (digested yesterday) from agarose gel - yesterday's digests didn't work properly so second attempt made. Nonetheless, backbone fragment excised from gel and cleaned up |
28th August 2009 | Ran 10ul of pGFP-rrnB treated with EcoRI and 10ul of pGFP-rrnB + NheI on some agarose gel for analysis. Additionally, 5ul of the 8Kb pGFP-rrnB digest fragment was ran on gel. |
1st September 2009 | Attempted to amplify the three sets of sigA promoter using PCR |
2nd September 2009 | Carried out two DNA gel electrophoresis attempts in analysing the 3 variant sets of sigA promoters - both gel photographs show negative results |
3rd September 2009 | Cleaned up the PCR products for another run of DNA gel electrophoresis tomorrow. |
4th September 2009 | C0, V1, V2 and V3 PCR products analysis |
News
Events
- 20 – 21 June 2009 - Europe workshop (London)
- 23 – 24 June 2009 - UK iGEM meetup (Edinburgh)
- 23 October Practice Presentation (Newcastle)
- 23 October T-shirts are ready
- 27 October Practice Presentation (Sunderland)
- 27 October Poster is ready
- 30 October – 2 November 2009 - Jamboree (Boston)
Social Net
- Newcastle iGEM Twitter
- [http://www.facebook.com/home.php#/group.php?gid=131709337641 Newcastle on Facebook]
- [http://www.youtube.com/user/newcastle2009igem Newcastle Youtube Channel]