Team:TUDelft/Conjugation Procedure

From 2009.igem.org

(Difference between revisions)
(Experimental Procedures)
(Experimental Procedures)
 
(6 intermediate revisions not shown)
Line 1: Line 1:
{{Template:TUDelftiGEM2009_menu_M1_conj}}
{{Template:TUDelftiGEM2009_menu_M1_conj}}
-
=Experimental Procedures=
+
='''Experimental Procedures'''=
 +
 
 +
This page contains the step-by-step plan followed by the conjugation team and each steps current status.
=='''Section 1: Helper Plasmid'''==
=='''Section 1: Helper Plasmid'''==
Line 8: Line 10:
Part 1A:
Part 1A:
* Acquire R751 plasmid [https://2009.igem.org/Team:TUDelft/31_July_2009#Calin <font color=limegreen>&#10004;</font>]
* Acquire R751 plasmid [https://2009.igem.org/Team:TUDelft/31_July_2009#Calin <font color=limegreen>&#10004;</font>]
-
* Confirm wild R751 conjugation [https://2009.igem.org/Team:TUDelft/6_August_2009 <font color=limegreen>&#10004;</font>]
+
* Confirm wild R751 conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
-
* Characterize conjugation efficiency [https://2009.igem.org/Team:TUDelft/6_August_2009 <font color=limegreen>&#10004;</font>]
+
* Characterize conjugation efficiency [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
Line 35: Line 37:
===Knockouts===
===Knockouts===
-
The &lambda;-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work [http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio] or [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]. Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used:
+
The &lambda;-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):
-
trbK_KO_FWD
+
trbK_KO_FWD (70 bp)
 +
CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font>
-
trbK_KO_REV
+
trbK_KO_REV (70 bp)
 +
GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACC<font color=red>ATGGGAATTAGCCATGGTCC</font>
-
oriTR_KO_FWD
+
oriTR_KO_FWD (70 bp)
 +
TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTC<font color=red>GTGTAGGCTGGAGCTGCTTC</font>
-
oriTR_KO_REV
+
oriTR_KO_REV (70 bp)
 +
 
 +
TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCG<font color=red>ATGGGAATTAGCCATGGTCC</font>
 +
 
 +
The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):
 +
 
 +
trbK_KO_FWD (20 bp)
 +
 
 +
<font color=blue>CACAACTGCG</font>CCAGGGCAGC
 +
 
 +
trbK_KO_REV (20 bp)
 +
 
 +
<font color=blue>CAGACGAACA</font>GCGGCAGGGC
 +
 
 +
oriTR_KO_FWD (20 bp)
 +
 
 +
<font color=blue>CTGGCCCACG</font>TCGCGCAGAT
 +
 
 +
oriTR_KO_REV (20 bp)
 +
 
 +
<font color=blue>TTGTGGCGGG</font>TTTCGCTATA
Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See [[Team:TUDelft/Conjugation_Results | Results]] page for more info.
Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See [[Team:TUDelft/Conjugation_Results | Results]] page for more info.
Line 56: Line 81:
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>&#10004;</font>]
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK) [https://2009.igem.org/Team:TUDelft/7_August_2009#Calin <font color=limegreen>&#10004;</font>]
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
-
* Verify that trbK expression blocks conjugation [https://2009.igem.org/Team:TUDelft/19_August_2009#Calin <font color=limegreen>&#10004;</font>]
+
* Verify that trbK expression blocks conjugation [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
-
* Place trbK on standard backbone <font color=limegreen>&#10004;</font>, sequence <font color=limegreen>&#10004;</font>, and send to registry <font color=limegreen>&#10004;</font>
+
* Place trbK on standard backbone [https://2009.igem.org/Team:TUDelft/11_August_2009#Calin <font color=limegreen>&#10004;</font>], sequence [https://static.igem.org/mediawiki/2009/9/9e/V92371145_E_VF_QS.txt <font color=limegreen>&#10004;</font>], and send to registry <font color=limegreen>&#10004;</font>
* Amplify and Transform BioBricks needed
* Amplify and Transform BioBricks needed
** [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
** [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
Line 64: Line 89:
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
** [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term) <font color=limegreen>&#10004;</font>
* Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] <font color=limegreen>&#10004;</font>
* Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT] <font color=limegreen>&#10004;</font>
-
* Verify Conjugation Testing Plasmid 1 works. <font color=limegreen>&#10004;</font>
+
* Verify Conjugation Testing Plasmid 1 works. [[Team:TUDelft/Conjugation_Results | <font color=limegreen>&#10004;</font>]]
* Sequence Conjugation Testing Plasmid 1. <font color=blue><b>**In Progress**</b></font>
* Sequence Conjugation Testing Plasmid 1. <font color=blue><b>**In Progress**</b></font>
* Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] <font color=limegreen>&#10004;</font>
* Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT] <font color=limegreen>&#10004;</font>
Line 79: Line 104:
'''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page'''
'''For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the [[Team:TUDelft/Conjugation_Cloning|cloning strategy]] page'''
-
 
+
On to the [[Team:TUDelft/Conjugation_Results | Experimental Results >>>]]
{{Template:TUDelftiGEM2009_end}}
{{Template:TUDelftiGEM2009_end}}

Latest revision as of 22:43, 19 October 2009

Experimental Procedures

This page contains the step-by-step plan followed by the conjugation team and each steps current status.

Section 1: Helper Plasmid

Section 1: The Plan

Part 1A:

  • Acquire R751 plasmid
  • Confirm wild R751 conjugation
  • Characterize conjugation efficiency


Part 1B: oriTR knockout

  • Design and order primers needed for λ-red knockout
  • Acquire knockout plasmids
  • Knockout oriTR **In Progress**
  • Verify that conjugation stopped **In Progress**
  • Characterize conjugation efficiency of Conjugation Testing Plasmid 1 with R751 ΔoriTR as helper
  • Send R751 ΔoriTR plasmid to registry


Part 1C: trbK knockout

  • Knockout trbK **In Progress**
  • Verify that conjugation takes place among R751 ΔtrbK cells
  • Characterize conjugation efficiency
  • Send R751 ΔoriT + ΔtrbK plasmid to registry


Part 1D: trbC knockout

  • Knockout trbC
  • Verify that no conjugation takes place in presence of Conjugation Testing Plasmid 1
  • Send R751 ΔoriT + ΔtrbK + ΔtrbC plasmid to registry

Knockouts

The λ-red knockout system was selected as the procedure for doing the knockouts. It had previously been used by several people and demonstrated to work ([http://openwetware.org/wiki/Recombineering/Lambda_red-mediated_gene_replacement lambda red], [http://openwetware.org/wiki/NanoBio:_Protocol_for_gene_knockout NanoBio], [http://openwetware.org/wiki/Berk2006-ConjugationTeam knockout protocol used by Berkeley '06]). Primers were designed following the standard [http://openwetware.org/wiki/NanoBio:_Primer_Design procedure]. The following primers were used (red parts are P1 and P2):

trbK_KO_FWD (70 bp)

CCAGGGCAGCTACCGGGCCAGCCCGGCGCGCACCTGGTAAGGGGGGATTCGTGTAGGCTGGAGCTGCTTC

trbK_KO_REV (70 bp)

GCGGCAGGGCGAGGGTTTTTAGATTGGCTGGCATTCTCATCGTCAGCACCATGGGAATTAGCCATGGTCC

oriTR_KO_FWD (70 bp)

TCGCGCAGATAGCGCGCCACGCTGACGCCCGCCCTCTTGGCGTTCGCCTCGTGTAGGCTGGAGCTGCTTC

oriTR_KO_REV (70 bp)

TTTCGCTATATCCGTTGCTGCTTTTGCGGCCTGATAGCGCGATAGTTGCGATGGGAATTAGCCATGGTCC

The following verification primers were used (blue portions are on R751 outside the 50 bp upstream region):

trbK_KO_FWD (20 bp)

CACAACTGCGCCAGGGCAGC

trbK_KO_REV (20 bp)

CAGACGAACAGCGGCAGGGC

oriTR_KO_FWD (20 bp)

CTGGCCCACGTCGCGCAGAT

oriTR_KO_REV (20 bp)

TTGTGGCGGGTTTCGCTATA

Linear fragments were created using pKD4 (KAN) as a template using Platinum® Pfx DNA Polymerase. See Results page for more info.

Section 2: Message Plasmid

Part 2A: BioBrick Assembly

  • Order DNA synthesis for
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175001 BBa_K175001] (trbK)
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_K175000 BBa_K175000] (trbC)
  • Verify that trbK expression blocks conjugation
  • Place trbK on standard backbone , sequence , and send to registry
  • Amplify and Transform BioBricks needed
    • [http://partsregistry.org/Part:BBa_I13522 BBa_I13522] (pTet-RBS-GFP-term-term)
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_I714031 BBa_I714031] (oriTR)
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_J13002 BBa_J13002] (pTet-RBS)
    • [http://partsregistry.org/wiki/index.php?title=Part:BBa_E0840 BBa_E0840] (RBS-GFP-term-term)
  • Assemble Conjugation Testing Plasmid 1: [promoter][GFP generator][oriT]
  • Verify Conjugation Testing Plasmid 1 works.
  • Sequence Conjugation Testing Plasmid 1. **In Progress**
  • Assemble Conjugation Testing Plasmid 2 [promoter][rbs][trbK][rbs][GFP][oriT]
  • Verify Conjugation Testing Plasmid 2 works. **In Progress**
  • Sequence Conjugation Testing Plasmid 2. **In Progress**


Part 2B: Full Communication testing

  • Electroporate Conjugation Testing Plasmid 2 into some R751 ΔoriT cells creating InitiatorCells (select for presence of both message and helper plasmid)
  • Add InitiatorCells to a culture of R751 ΔoriT + ΔtrbK and observe signal propagation, characterize rate of signal propagation. Look for lethal zygosis issues.
  • If signal propagation observed, do victory dance.


For more information on the cloning strategy of constructing the conjugation plasmids and knockouts check the cloning strategy page

On to the Experimental Results >>>