Team:TUDelft/Brainstorm/Plasmid

From 2009.igem.org

(Difference between revisions)
(Implementation)
(Implementation)
 
(3 intermediate revisions not shown)
Line 10: Line 10:
# Package
# Package
## Selection Marker (Antibiotic resistance)
## Selection Marker (Antibiotic resistance)
-
## Selection Marker Promoter
+
### Chloramphenicol
 +
### Kanamycin
 +
### Tetracyclin
 +
## Selection Marker Promoter (constitutive)
## Payload, gene to express in signal (GFP for testing)
## Payload, gene to express in signal (GFP for testing)
## Payload Promoter
## Payload Promoter
# Restriction Enzyme
# Restriction Enzyme
## Homing endonucleases
## Homing endonucleases
-
### I-SceI (30 bp recognition seq) (BBa_K142200) [http://partsregistry.org/Part:BBa_K142200] [http://www.neb.com/nebecomm/products/productR0694.asp]
+
### I-SceI (233 aa) (BBa_K142200) [http://partsregistry.org/Part:BBa_K142200] [http://www.neb.com/nebecomm/products/productR0694.asp] [http://www.genome.wisc.edu/functional/tnmutagenesis.htm]
-
### I-CeuI (29 bp recognition seq) [http://www.neb.com/nebecomm/products/productR0699.asp]
+
### PI-SceI (479 aa) [http://www.neb.com/nebecomm/products/productR0696.asp]
-
### PI-SceI (37 bp recognition seq) [http://www.neb.com/nebecomm/products/productR0696.asp]
+
### I-PpoI (163 aa) [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_547]
-
### I-PpoI (15 bp recognition seq) [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_547]
+
### I-TevI (245 aa) [http://mcl1.ncifcrf.gov/waugh_tech/faq/tev.pdf]
-
# Restriction Enzyme Promoter
+
### <s>I-CeuI</s> (19 bp recognition seq) cuts E.coli genome into 7 fragments [http://www.neb.com/nebecomm/products/productR0699.asp] [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=47035]
 +
### <s>PI-PspI</s> needs high temp [http://www.neb.com/nebecomm/products/productR0695.asp]
# Restriction Enzyme Recognition Sequence (multiple sites?)
# Restriction Enzyme Recognition Sequence (multiple sites?)
 +
## I-SceI (18 bp recognition seq) (TAGGGATAACAGGGTAAT) (4 bp overhang) [http://rebase.neb.com/rebase/enz/I-SceI.html]
 +
## PI-SceI (37 bp recognition seq) (ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG) (4 bp overhang) [http://rebase.neb.com/rebase/enz/PI-SceI.html]
 +
## I-PpoI (15 bp recognition seq) (CTCTC TTAAGGTAGC) (4 bp overhang) [http://rebase.neb.com/rebase/enz/I-PpoI.html]
 +
## I-TevI (21 bp recognition seq) (GAAAACCTGTATTTTCAGGGC) (Glu-Asn-Leu-Tyr-Phe-Gln-Gly) (2 bp overhang) [http://rebase.neb.com/rebase/enz/I-TevI.html] [http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&entryPoint=adirect&productID=12575015&messageType=catProductDetail]
 +
# Restriction Enzyme Promoter
Timeline
Timeline
Line 60: Line 69:
* F plasmid is very large [http://people.rit.edu/~gtfsbi/IntroMicro/20071images/10_F18.jpg]
* F plasmid is very large [http://people.rit.edu/~gtfsbi/IntroMicro/20071images/10_F18.jpg]
**  oriT sequence in F plasmid initiates rolling circle amplification and transfer of the plasmid to the recipient cell
**  oriT sequence in F plasmid initiates rolling circle amplification and transfer of the plasmid to the recipient cell
-
**  can knockout oriT from F plasmid (See Berkeley 2006 project http://parts.mit.edu/wiki/index.php/Berkeley2006-ConjugationMain) and put on smaller plasmid
+
**  can knockout oriT from F plasmid (See Berkeley 2006 project https://2006.igem.org/Berkeley2006-ConjugationMain) and put on smaller plasmid
** how to differentiate between donors and recipients, link expression of modified F plasmid to presence of smaller plasmid?
** how to differentiate between donors and recipients, link expression of modified F plasmid to presence of smaller plasmid?

Latest revision as of 09:56, 11 June 2009

Self Destructing Plasmid Brainstorm Area

Contents


Implementation

Main Components

  1. Package
    1. Selection Marker (Antibiotic resistance)
      1. Chloramphenicol
      2. Kanamycin
      3. Tetracyclin
    2. Selection Marker Promoter (constitutive)
    3. Payload, gene to express in signal (GFP for testing)
    4. Payload Promoter
  2. Restriction Enzyme
    1. Homing endonucleases
      1. I-SceI (233 aa) (BBa_K142200) [http://partsregistry.org/Part:BBa_K142200] [http://www.neb.com/nebecomm/products/productR0694.asp] [http://www.genome.wisc.edu/functional/tnmutagenesis.htm]
      2. PI-SceI (479 aa) [http://www.neb.com/nebecomm/products/productR0696.asp]
      3. I-PpoI (163 aa) [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_547]
      4. I-TevI (245 aa) [http://mcl1.ncifcrf.gov/waugh_tech/faq/tev.pdf]
      5. I-CeuI (19 bp recognition seq) cuts E.coli genome into 7 fragments [http://www.neb.com/nebecomm/products/productR0699.asp] [http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=47035]
      6. PI-PspI needs high temp [http://www.neb.com/nebecomm/products/productR0695.asp]
  3. Restriction Enzyme Recognition Sequence (multiple sites?)
    1. I-SceI (18 bp recognition seq) (TAGGGATAACAGGGTAAT) (4 bp overhang) [http://rebase.neb.com/rebase/enz/I-SceI.html]
    2. PI-SceI (37 bp recognition seq) (ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG) (4 bp overhang) [http://rebase.neb.com/rebase/enz/PI-SceI.html]
    3. I-PpoI (15 bp recognition seq) (CTCTC TTAAGGTAGC) (4 bp overhang) [http://rebase.neb.com/rebase/enz/I-PpoI.html]
    4. I-TevI (21 bp recognition seq) (GAAAACCTGTATTTTCAGGGC) (Glu-Asn-Leu-Tyr-Phe-Gln-Gly) (2 bp overhang) [http://rebase.neb.com/rebase/enz/I-TevI.html] [http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&entryPoint=adirect&productID=12575015&messageType=catProductDetail]
  4. Restriction Enzyme Promoter

Timeline

Promoter Selection

Applications

Recycling Selectable Marker Genes

Metabolic Control Analysis

Cell-Cell Signaling

Synchronization

  • Use F plasmid
  • address problems with AHL signaling
    • 24 hr half-life at 7.5pH means media becomes saturated (http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1797063 and http://parts2.mit.edu/projects/iap2003/Prakash/index.htm#Challenges)
  • "important that a degradation mechanism that is faster than the desired period of oscillations be introduced into the system"
  • solutions previously attempted
    • aiiA degradation enzyme not secreted
    • in the paper: S. Basu, R. Mehreja, S. Thiberge, M. T. Chen, and R. Weiss, Spatiotemporal control of gene expression with pulse-generating networks, Proc. Natl. Acad. Sci. USA, 101 (2004), pp. 6355–6360. http://www.pnas.org/content/101/17/6355.full
      • two relevant experiments from Pulse Regeneration section
        • first pulse 4hr AHL induction, then cells washed three times with new media, grown 6 hr in fresh media, then second pulse reaches same intensity levels as first
        • first pulse 6hr AHL induction, then cells washed and resuspended in new media, second pulse can reach same intensity levels as first, after waiting 140 min before addition of second AHL
  • washing cells not always practical
  • Implementation
  • F plasmid modified to have a gene of interest for signal generation and a self destructive endonuclease instead of AHL for cell signaling, F plasmid transmitted by conjugation [http://people.rit.edu/~gtfsbi/IntroMicro/20071images/10_F22a.jpg]
  • Tradeoff (F plasmid vs. AHL): F plasmid has better rate of degradation (tunable) but worse rate of propagation.
  • From the paper: A comparison of the kinetics of plasmid transfer in the conjugation systems encoded by the F plasmid from Escherichia coli and plasmid pCF10 from Enterococcus faecalis. Andrup L, Andersen K. Microbiology. 1999 Aug;145 ( Pt 8):2001-9. http://www.ncbi.nlm.nih.gov/pubmed/10463166
    • "the plasmid's maximal conjugation rate was estimated to be approximately 0.15 transconjugants per donor per minute."
    • "the donors underwent a 'recovery period' between rounds of conjugative transfer and newly formed transconjugants required a period of about 40-80 min to mature into proficient donors."
  • F plasmid is very large [http://people.rit.edu/~gtfsbi/IntroMicro/20071images/10_F18.jpg]
    • oriT sequence in F plasmid initiates rolling circle amplification and transfer of the plasmid to the recipient cell
    • can knockout oriT from F plasmid (See Berkeley 2006 project https://2006.igem.org/Berkeley2006-ConjugationMain) and put on smaller plasmid
    • how to differentiate between donors and recipients, link expression of modified F plasmid to presence of smaller plasmid?

I. Synchronization:

  1. Add F plasmid using electroporation
  2. Allow conjugation to increase F+ population
  3. Induce synchronization and self destruction -> all cells now back to F-
  4. Next pulse, add F+ cells and repeat
  • modeling paper, Section 4 in particular: Synchrony in a Population of Hysteresis-Based Genetic Oscillators, Alexey Kuznetsov, Mads Kærn, and Nancy Kopell, SIAM J. Appl. Math. Volume 65, Issue 2, pp. 392-425 (2004), http://scitation.aip.org/getabs/servlet/GetabsServlet?prog=normal&id=SMJMAP000065000002000392000001&idtype=cvips&gifs=yes


Complex Spatiotemporal Pattern Generation

  • A synthetic multicellular system for programmed pattern formation, Subhayu Basu, Yoram Gerchman, Cynthia H. Collins, Frances H. Arnold & Ron Weiss, http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html
  • Artificial cell-cell communication in yeast Saccharomyces cerevisiae using signaling elements from Arabidopsis thaliana, http://www.nature.com/nbt/journal/v23/n12/full/nbt1162.html