• Home
• Team
• Project
• Parts
• Modelling
• Sponsors
• Lab Book

Project

• Overview
• Choices Rationale
• Characterisation
• Safety
• Judging Comments

Sub-projects

• Metal Intake/Efflux
• Metal Sensing
• Sporulation Tuning
• Population Dynamics
• Stochastic Switch
• Metal Sequester
• Chassis
• Promoter Library

Wet Lab

• Lab Book
• Protocols

Meetings

• Meetings Calendar

Planning

• Timeline
• Ideas

Links

• Helping other teams
• Ethics
• T-Shirts
• iGEM Meetup
• Our City
• Fun and Games
• Sponsors
• Useful Links
• Contact Us
• Press Coverage

Promoter Library

Please click on the following links to learn more about the promoter library sub-project:

• Introduction
• Novelty in this sub-project
• Design
• Lab Work Strategies
• Progress

Introduction

In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.

Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.

Novelty in this sub-project

The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.

Design

Template used to create the promoter sequences:

Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix

• BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
• UpSpacer - attta - consensus sigA 5 bases 5'
• -35 - TTGACA
• PromSpacer - length 17 - consensus ttttatttaaattatga
• -10 - TATAAT
• DownSpacer (from ackA)- ggaaaag
• BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag

Variants

We designed three degenerate sequences to create a library of promoters which we hope will have different strengths.

Variant 1

In this variant we only modified the -35 and -10 consensus sequences.

BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix

Variant 2

In the second variant we modified the promoter sequence between the -35 and -10 regions.

BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix

Variant 3

In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region.

BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix

Lab Work Strategies

• Synthesis other strand using polymerase and a primer

• Cut promoter fragments using EcoR1 and Pst1
• Cut pSB1AT3 vector using EcoR1 and Pst1
• Ligate the insert and the plasmid backbone, and transform E. coli DH5alpha
• Subclone into Bacillus integration vector with gfp and insert at amyE

Progress

The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised. This is all of the lab work in which the Metal Sensing Team attempted to construct the cadmium sensor - click on the dates to read that day's lab entry:

Summary of Lab Sessions for Promoter Library
Date	Description
26th August 2009	Digested 15ul of pGFP-rrnB plasmid with NheI and EcoRI
27th August 2009	Attempted to remove the pGFP-rrnB backbone fragment (digested yesterday) from agarose gel - yesterday's digests didn't work properly so second attempt made. Nonetheless, backbone fragment excised from gel and cleaned up