From 2009.igem.org

(Difference between revisions)

Revision as of 02:37, 22 October 2009

Meetings Calendar

Promoter Library

Please click on the following links to learn more about the promoter library sub-project:

Introduction
Novelty in this sub-project
Design
Lab Work Strategies
Progress

Introduction

In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.

Several efforts to produce parts libraries are currently underway. As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.

Novelty in this sub-project

The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.

Design

Template used to create the promoter sequences:

Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix

BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
UpSpacer - attta - consensus sigA 5 bases 5'
-35 - TTGACA
PromSpacer - length 17 - consensus ttttatttaaattatga
-10 - TATAAT
DownSpacer (from ackA)- ggaaaag
BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag

Variants

We designed three degenerate sequences to create a library of promoters which we hope will have different strengths.

Variant 1

In this variant we only modified the -35 and -10 consensus sequences.

BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix

Variant 2

In the second variant we modified the promoter sequence between the -35 and -10 regions.

BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix

Variant 3

In the third variant we changed the last two bases of the minus 35 region and the first two bases of the -10 region.

BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix

Lab Work Strategies

Synthesis other strand using polymerase and a primer

Cut promoter fragments using EcoR1 and Pst1
Cut pSB1AT3 vector using EcoR1 and Pst1
Ligate the insert and the plasmid backbone, and transform E. coli DH5alpha
Subclone into Bacillus integration vector with gfp and insert at amyE

Progress

The consensus and variant sequences were designed and ordered from GeneArt. Once received they were PCRd, but we ran out of time, and the library has not been characterised. This is all of the lab work in which the Metal Sensing Team attempted to construct the cadmium sensor - click on the dates to read that day's lab entry:

Summary of Lab Sessions for Promoter Library
Date	Description
26th August 2009	Digested 15ul of pGFP-rrnB plasmid with NheI and EcoRI
27th August 2009	Attempted to remove the pGFP-rrnB backbone fragment (digested yesterday) from agarose gel - yesterday's digests didn't work properly so second attempt made. Nonetheless, backbone fragment excised from gel and cleaned up
28th August 2009	Ran 10ul of pGFP-rrnB treated with EcoRI and 10ul of pGFP-rrnB + NheI on some agarose gel for analysis. Additionally, 5ul of the 8Kb pGFP-rrnB digest fragment was ran on gel.
1st September 2009	Attempted to amplify the three sets of sigA promoter using PCR

20 – 21 June 2009 - Europe workshop (London)
23 – 24 June 2009 - UK iGEM meetup (Edinburgh)
23 October Practice Presentation (Newcastle)
23 October T-shirts are ready
27 October Practice Presentation (Sunderland)
27 October Poster is ready
30 October – 2 November 2009 - Jamboree (Boston)

Newcastle iGEM Twitter
[http://www.facebook.com/home.php#/group.php?gid=131709337641 Newcastle on Facebook]
[http://www.youtube.com/user/newcastle2009igem Newcastle Youtube Channel]

@@ Line 105: / Line 105: @@
 |'''[https://2009.igem.org/Team:Newcastle/Labwork/28_August_2009#Promoter_Library_Sub-Project 28th August 2009]'''
 | Ran 10ul of pGFP-rrnB treated with EcoRI and 10ul of pGFP-rrnB + NheI on some agarose gel for analysis. Additionally, 5ul of the 8Kb pGFP-rrnB digest fragment was ran on gel.
+|-
+|'''[https://2009.igem.org/Team:Newcastle/Labwork/1_September_2009#Promoter_Library_Sub-Project 1st September 2009]'''
+| Attempted to amplify the three sets of sigA promoter using PCR
 |-
 |}

Team:Newcastle/Promoter Library