Team:Newcastle/Promoter Library

From 2009.igem.org

(Difference between revisions)
(Design)
(Variances)
Line 35: Line 35:
===Variances===
===Variances===
We designed three variances to create library of promoters with different strengths.
We designed three variances to create library of promoters with different strengths.
-
+
 
-
# Degenerating -35 and -10 sequences.
+
-
  BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix
+
-
# BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
+
# BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
# BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
====Variance 1 ====
====Variance 1 ====
-
In this variance we only degenerate -35 and -10 sequences.
+
In this variance we degenerate -35 and -10 sequences.
 +
BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix
[[Image:Team_Newcastle_iGEM_Promoter_Library3.png]]
[[Image:Team_Newcastle_iGEM_Promoter_Library3.png]]
Line 52: Line 50:
====Variance 2 ====
====Variance 2 ====
In the second variance we use N's for the promoter sequence between -35 and -10 regions
In the second variance we use N's for the promoter sequence between -35 and -10 regions
 +
BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix
[[Image:Team_Newcastle_iGEM_Promoter_Library5.png|500px]]
[[Image:Team_Newcastle_iGEM_Promoter_Library5.png|500px]]
Line 60: Line 59:
====Variance 3 ====
====Variance 3 ====
In the third variance we change the last two bases of minus 35 region and the first two bases of -10 region.
In the third variance we change the last two bases of minus 35 region and the first two bases of -10 region.
 +
 +
BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix
 +
[[Image:Team_Newcastle_iGEM_Promoter_Library6.png|500px]]
[[Image:Team_Newcastle_iGEM_Promoter_Library6.png|500px]]

Revision as of 21:24, 21 October 2009


Promoter Library

Introduction

In order to effectively model genetic circuits, databases of parts with known characteristics are essential. Without such databases, computationally designed circuits may not be feasible to implement in vivo. Unfortunately, parameters such as promoter strength, RBS affinity, transcription, translation and decay rates are hard to find in the literature, and those which do exist are rarely measured under standardised conditions.

Several efforts to produce parts libraries are currently underway.As part of our contribution to synthetic biology, we decided to create a promoter library for B. subtilis.

Novelty in this sub-project

The novelty in this sub-project lies in the generation of a large number of B. subtilis promoters, based upon carefully considered variations to an existing promoter region. We chose the promoter region of the transcription factor SigmaA, since it is the most widely-used promoter in B. subtilis. Over 300 genes are controlled by SigA. Their promoter regions have highly conserved -10 and -35 regions, surrounded by variable sequences.

Design

Template used to create the promoter sequences:

Prefix...UpSpacer...-35...PromSpacer...-10...DownSpacer..Suffix

Team Newcastle iGEM Promoter Library1.png

Team Newcastle iGEM Promoter Library2.png


  • BBPrefix - StandardBioBrickPrefix EcoR1 and Xba1 - gaattcgcggccgcttctagag
  • UpSpacer - attta - consensus sigA 5 bases 5'
  • -35 - TTGACA
  • PromSpacer - length 17 - consensus ttttatttaaattatga
  • -10 - TATAAT
  • DownSpacer (from ackA)- ggaaaag
  • BBSuffix - Standard BioBrick suffix Spe1 and Pst1 - tactagtagcggccgctgcag

Variances

We designed three variances to create library of promoters with different strengths.

  1. BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix


Variance 1

In this variance we degenerate -35 and -10 sequences.

BBPrefix...UpSpacer...N-35... PromSpacer...N-10...DownSpacer..BBSuffix

Team Newcastle iGEM Promoter Library3.png

Team Newcastle iGEM Promoter Library4.png


Variance 2

In the second variance we use N's for the promoter sequence between -35 and -10 regions

BBPrefix...UpSpacer...-35... 18N’s...-10...DownSpacer..BBSuffix

Team Newcastle iGEM Promoter Library5.png

Team Newcastle iGEM Promoter Library7.png


Variance 3

In the third variance we change the last two bases of minus 35 region and the first two bases of -10 region.

BBPrefix...UpSpacerNN...-35...NNPromSpacerNN...-10...NNDownSpacer..BBSuffix

Team Newcastle iGEM Promoter Library6.png

Lab Work Strategies

  • Synthesis other strand using polymerase and a primer

Team Newcastle iGEM Promoter Library8.png

  • Cut promoter fragments using EcoR1 and Pst1
  • Cut pSB1AT3 vector using EcoR1 and Pst1
  • Ligate the insert and the plasmid backbone, and transform E. coli DH5alpha
  • Subclone into Bacillus integration vector with gfp and insert at amyE





News

Events

Social Net

  • Newcastle iGEM Twitter
  • [http://www.facebook.com/home.php#/group.php?gid=131709337641 Newcastle on Facebook]
  • [http://www.youtube.com/user/newcastle2009igem Newcastle Youtube Channel]